vol_53_2010-1
Post on 05-Aug-2015
162 Views
Preview:
TRANSCRIPT
UNIVERSITATEA DE ȘTIINȚE AGRICOLE ȘI MEDICINĂ VETERINARĂ
“ION IONESCU DE LA BRAD” IAȘI
LUCRĂRI ȘTIINȚIFICE VOL. 53 (12)
MEDICINĂ VETERINARĂ PARTEA 1
EDITURA “ION IONESCU DE LA BRAD” IAȘI 2010
COLEGIUL DE REDACȚIE Redactor responsabil: Prof. univ. dr. Gheorghe SOLCAN Redactor adjunct: Prof. univ. dr. Octavian Zaharie OPREAN Membri: Prof. univ. dr. Corneliu COTEA Prof. univ. dr. Vasile VULPE Prof. univ. dr. Mihai CARP‐CĂRARE Prof. univ. dr. Dan DRUGOCIU
COMISIA DE REFERENȚI ȘTIINȚIFICI Prof. univ. dr. Octavian Zaharie OPREAN Prof. univ. dr. Abdelfatah NOUR – Universitatea Pudue, SUA Prof. univ. dr. H.C. Francois CRESPEAU – ENV Alfort, France Prof. univ. dr. Gheorghe SOLCAN Prof. univ. dr. Liviu MIRON Prof. univ. dr. Gheorghe SĂVUȚA Prof. univ. dr. Gabriel PREDOI – FMV București Prof. univ. dr. Ioan Ștefan GROZA – FMV Cluj Napoca Prof. univ. dr. Gheorghe DĂRĂBUȘ ‐ FMV Timișoara Prof. univ. dr. Corneliu COTEA Prof. univ. dr. Mihai CARP‐CĂRARE Conf. univ. dr. Șerban MOROȘAN – INSERM Paris Prof. univ. dr. H.C. Liviu RUNCEANU Prof. univ. dr. Tudor PERIANU Prof. univ. dr. Ioan COMAN Prof. univ. dr. Elena VELESCU
Volumul a fost editat cu sprijinul financiar al Ministerului Educației, Cercetării, Tineretului și Sportului
ISSN: 1454‐7406
CURPINS
PARTEA I ALINA ANTON, GHEORGHE SOLCAN, VASILE BOGHIAN, NICOLAE HAGIU BIOCHEMICAL AND HAEMATOLOGICAL PROFILE IN THE ADVANCED GESTATION PERIOD OF COPPER DEFICIENT HOLSTEIN AND BROWN SWISS CATTLE ATTIA, H.F AND MAZHER, K HISTOLOGICAL AND IMMUNOHISTOCHEMICAL STUDIES OF THE BUCK'S PINEAL GLAND DURING LIGHT AND DARK PERIODS S. BESCHEA‐CHIRIAC COMPARATIVE STUDY OF VASCULAR ARTERIAL REACTIVITY AT SEVERAL MAMMAL SPECIES: . THE REACTIVITY OF ARTERIAL SMOOTH MUSCLES AT THE VASOCONSTRICTOR AGENTS ANTIDIURETIC HORMONE (VASOPRESSIN) BOGHIAN V., MĂLĂNCUŞ R.N., ACATRINEI D., PAȘCA S., ANTON ALINA, SOLCAN GH. MORPHOCLINICAL ASPECTS OF BABESIOSIS IN HORSES IOANA BURCOVEANU, I. BURTAN, ROXANA TOPALĂ, L.C. BURTAN, M. FÂNTÂNARIU KERATOPATHIES IN CARNIVORES: CLINICAL SIGNS AND LOCAL PATHOLOGIC RESPONSES HÉLÈNE HUET , DELPHINE FRANKO , CHAKIB DJEDIAT, EVA PEREZ , FRANÇOIS CRESPEAU , AMAURY DE LUZE PATHOLOGICAL EFFECTS AND TISSUE DISTRIBUTION OF MICROCYSTIN‐LR (MC‐LR) AFTER 48 HOURS NON INVASIVE EXPOSITION OF NEWLY HATCHED MEDAKA (ORYZIAS LATIPES) ELEUTHERO‐EMBRYOS GH. DĂRĂBUŞ , V. COZMA , K. IMRE , A. BEJAN , M.S.ILIE , MIRELA IMRE
PREVALENCE OF CRYPTOSPORIDIUM SPP. AND OTHER ENTEROPATHOGENS INFECTIONS AT CALVES IN WESTERN, CENTRAL AND NORTH‐WESTERN ROMANIA GAL A.F. , CATOI C. , BABA AI , MICLAUS V. , BOLFA P. , TAULESCU M , TABARAN F. , NAGY A. , MOUSSA R. , COSMINA CUC ASPECTS REGARDING VASCULOGENIC MIMICRY IN CANINE MAMMARY CANCER GRECU MARIANA , NĂSTASĂ V. , MAREŞ M. , MORARU RAMONA, HRIȚCU LUMINIȚA DIANA , ILIE CORNELIA ASSESSMENT OF THE ANTI‐INFLAMMATORY ACTION OF THE CARPROFEN‐BETA CYCLODEXTRINS COMPLEX ON EXPERIMENTAL INFLAMMATION MODEL IN RATS
7 13 20 26 30 36 44 49 60
GROZA I.Ș, GROZA DARIA, PALL EMOKE, CENARIU M., CIUPE SIMONA, LAURA PARLAPAN EVALUATION OF DEGREE OF ENGRAFTMENT IN MOUSE MODEL OF STEM CELLS HARVESTED FROM HUMAN PLACENTA IONELA HOTEA, GH. DARABUS, C. PACURAR, TATIANA RUGEA, P. MUNTEAN, M.S. ILIE, K. IMRE, MIRELA IMRE, DENISA SORESCU, ADRIAN BALINT, DINU INDRE PRELIMINARY STUDY ON THE PREVALENCE OF TOXOPLASMA GONDII INFECTION IN WILD BOARS FROM TIMIS COUNTY OLIMPIA C. IACOB, B.C. ŞÎŞCĂ EPIDEMIOLOGICAL INVESTIGATIONS ON DIGESTIVE PARASITOSIS IN RACING PIGEONS AND THE RISK OF RELEASING PARASITIC ELEMENTS IN FREE AREAS MARIANA IONITA , D.K. HOWE , I.L. MITREA , B. STEVENSON , MICHELLE YEARGAN PRELIMINARY DATA CONCERNING OPTIMIZATION OF A PCR‐BASED METHOD FOR MOLECULAR DETECTION OF TICK‐BORNE PATHOGENS ISMAIL, S.F ; ABD AL‐GALIL, A.S.A AND GEHAN, B.A.YOUSSEF PROPOFOL ANAESTHESIA IN DONKEYS IN COMBINATION WITH CHLORAL HYDRATE ADINA MARIA MANEA, S. E. GEORGESCU, STELIANA KEVORKIAN, SORINA DINESCU, MARIETA COSTACHE GENOTYPING ESTROGEN RECEPTOR POLYMORPHISM IN PIGS, USING THE PCR‐RFLP METHOD MICLĂUŞ V ., ANNE CLAUDIA ŞTEFĂNUȚ , ADRIANA MUREŞAN , C. OBER , V. RUS
COMPARATIVE TESTING OF SOME EXPERIMENTAL MODELS OF OXYGEN INDUCED RETINOPATHY IN YOUNG RATS. HISTOLOGICAL STUDY. MOUSSA RAOUAD.,C CATOI., B SEVASTRE., M TAULESCU., P BOLFĂ., A GAL., ,F.A TABARAN., A.L NAGY.,C CUC. EXPRESSION OF THE VIMENTIN MARKER IN DOG MELANIC CUTANEOUS TUMORS S.OANCEA , G.PAVEL , A.V.OANCEA ON THE SHAPE OF THE ERYTHROCYTES FROM SOME HERBIVORE MAMMALS S.OANCEA , S.PADUREANU , A.V.OANCEA
IDENTIFICATION OF PATHOLOGICAL STATES BASED ON RED BLOOD CELL AGGREGATION
OPREAN O.Z. , GHEBAN DIANA , FORNA NORINA CONSUELA , ŞINDILAR E.V. , GRĂMADĂ S.
STRUCTURAL MODIFICATIONS OF THE ORAL MUCOSA AND THE DENTAL APPARATUS INDUCED BY SOME DRUGS IN LABORATORY MICE
EMOKE PALL , GROZA I. , CENARIU M. , CRISTINA ILEA , OLGA SORITAU , CIPRIAN T ., BERCE C . ISOLATION, CHARACTERIZATION, PHENOTYPIZATION AND DIFFERENTIATION OF STEM CELLS FROM RAT PLACENTA
65 70 74 87 96
103
107
115
121
127
131
141
DUMITRIȚA RUGINA, ADELA PINTEA, ANDREA BUNEA, RALUCA POP, SANDA ANDREI LUTEIN PREVENTS HIGH GLUCOSE INDUCED OXIDATIVE STRESS IN HUMAN RPE CELLS
TRIF ALEXANDRA , DUMITRESCU EUGENIA , PETROVICI SNEJANA ALUMINIUM SULPHATE IMPACT ON FUNDAMENTAL BIOMARKERS OF REPRODUCTIVE FUNCTIONALITY IN FEMALE RATS (SUCKLING PERIOD EXPOSURE) WAEL M. EL‐DEEB, S.M. EL‐BAHR IMPROVEMENT OF GLUCOSE CONCENTRATION, LIPOPROTEIN PROFILE AND ANTIOXIDANT BIOMARKERS IN BLOOD OF NATURALLY DIABETIC BITCHES ADMINISTERED INSULIN WITH VITAMIN C OR VITAMIN E WAEL M. EL‐DEEB, ABD EL‐AZIZ ALMUJALLI, S. M. EL‐BAHR
INVESTIGATION OF SELECTED BIOCHEMICAL INDICATORS OF EXERTIONAL HABDOMYOLYSIS IN ARABIAN HORSES: PRO‐INFLAMMATORY CYTOKINES AND OXIDATIVE STRESS MARKERS
IHAB EL_ZOGHBY, AHMED KASSAB THE PARS DISTALIS (ANTERIOR PITUITARY) IN ONE‐HUMPED CAMEL (CAMELUS DROMEDARIUS ) : A MORPHOLOGICAL STUDY IHAB M. EL‐ZOGHBY LIGHT AND ELECTRON MICROSCOPE STUDIES OF THE ADRENAL GLANDS OF THE EGYPTIAN GEESE (ALOPOCHEN AEGYPTIACUS) PARTEA II GEHAN SAID AHMED AFIFY DETERMINATION OF SOME ANTIMICROBIAL RESIDUES IN CHICKEN MEAT AND GIBLETS. ADRIANA ANIȚĂ, DRAGOȘ ANIȚĂ, GHEORGHE SAVUȚA RESEARCHES REGARDING THE SEROPREVALENCE OF SWINE HEPATITIS E VIRUS INFECTION IN THE EAST OF ROMANIA DRAGOȘ CONSTANTIN ANIȚĂ, ADRIANA ANIȚĂ, GHEORGHE SAVUȚA SEROEPIDEMIOLOGICAL STUDY REGARDING INFECTIOUS BOVINE RHINOTRACHEITIS IN COUNTIES FROM NORTH OF MOLDOVA REGION CRISTINA BULBAŞA (PANAITE), D. DRUGOCIU, DANA DRUGOCIU, PANAITE C.G. USING SOMATIC CELLS COUNT AND BACTERIAL COUNT TO EVALUATE MILK PRODUCTION IN ONE DAIRY FARM IN IASSY COUNTRY PRIMIANI EDIANINGSIH, JAN ALEX SIWI SELECTION RESPONSES OF ALABIO DUCK (ANAS PLATIRINCHOS BORNEO) PRODUCTION IN INTENSIVE MAINTENANCE SYSTEM
145
153
158
170
183
195
213
219
222
226
230
EL‐ KOMY. A.A.A, EL‐ZOGHBY. R.R, ABD‐EL‐AZEM .M.A.TERATOLOGICAL AND PATHOLOGICAL STUDIES OF CEFOPERAZONE IN FEMALE ALBINO RATS SERGIU EMIL GEORGESCU, MARIA ADINA MANEA, STELIANA KEVORKIAN, MARIETA COSTACHE A NEW METHOD FOR ANALYZING THE AGOUTI LOCUS INVOLVED IN THE COAT COLOUR OF HORSES CRISTINA HORHOGEA, IVONA LAIU, CRISTINA RÎMBU, MIHAI CARP – CĂRARE FELINE INFECTIOUS PERITONITIS – CASE PRESENTATION STELIANA ELVIRA MARIA KEVORKIAN, S. E. GEORGESCU, MARIA ADINA MANEA, MARIA GEORGIANA GAVRILA, G. HRINCA, MARIETA COSTACHE THE SPIDER LAMB SYNDROME ABSENCE IN FIVE ROMANIAN SHEEP BREEDS HENDRONOTO ARNOLDUS WALEWANGKO LENGKEY, LOVITA ADRIANI IMPLICATION EFFECT OF PROBIOTIC BACTERIA TO YOGHURT QUALITY AND ENZYME ACTIVITIES LOVITA ADRIANI, HENDRONOTO A.W. LENGKEY PROBIOTIC BACTERIA AS YOGHURT STARTER AND ITS IMPLICATION EFFECT TO THE PATHOGENIC AND NON PATHOGENIC BACTERIA IN MICE GASTROINTESTINAL INA IULIANA MACOVEI, S. MANOLESCU, CRISTINA RÎMBU, S. PASCA, G. DRAGAN, GH.SAVUȚA STUDY OF AN OUTBREAK OF FOWL TYPHOID IN PHEASANTS CRISTINA RÎMBU, ELEONORA GUGUIANU, GH. SOLCAN, CRISTINA HORHOGEA, E.V. ȘINDILAR, C‐TIN. PAVLI, C. CARP‐CĂRARE CONSIDERATIONS ON THE ASSOCIATION OF PERIODONTAL DISEASE WITH OTHER ORGANIC DISEASES IN DOGS AND CATS ROOSTITA L. B., CISSY R. P., ERIC F.S., SRI M., HENDRONOTO A. W. L. THE INFLUENCE OF SEASONAL CHANGE TOWARDS THE NUMBER OF OUTBREAKS AND POULTRY DEATH RATE CAUSED BY AVIAN INFLUENZA AT BANDUNG DISTRICT GH.SAVUȚA , IULIANA ONIȚĂ, ADRIANA ANIȚĂ, D. ANIȚĂ, LUANDA LUDU, BEJANARIU ANA EPIDEMIOLOGICAL INVESTIGATIONS IN THE EAST OF ROMANIA REGARDING THE SEROPREVALENCE OF INFLUENTZA A TYPE VIRUSES IN DIFFERENT SPECIES OF ANIMALS JAN ALEX SIWI, PRIMIANI EDIANINGSIH AND DUDUNG MULLIADI PERFORMANS GENETIC QUALITATIVE AND QUANTITATIVE OF THIN TAIL SHEEP AND PRIANGAN SHEEP N. STARCIUC., NATALIA OSADCI., I. SCUTARU., T. SPATARU. THE OUTBREAKS OF INFECTIOUS BRONCHITIS OF CHICKENS IN PRIVATE POULTRY FARM
236
246
249
254
259
262
267
271
278
282
286
294
OANA RALUCA STRUGARU, FILIPPO TURRINI, ALESSANDRA SCAGLIARINI, ELENA VELESCU THE DETECTION OF ORF VIRUS BY PCR AT THE RUMINANS OF ROMANIA ALINA VLAD SABIE, VIOREL FLORIŞTEAN, CARMEN CREȚU, MIHAI OBADĂ, CĂTĂLIN CARP‐ CĂRARE, MIHAI CARP‐ CĂRARE DETECTION AND QUANTIFICATION OF SALMONELLA SPP. AND CAMPYLOBACTER JEJUNI ON POULTRY CARCASSES BY REAL‐TIME PCR MOHAMED YOUSEF RAMADAN AND ABLA DESOKY ABDEL‐MAGEID EPIDEMIOLOGICAL STUDY OF ECTOPARASITES IN STRAY DOGS IN KALUBYIA GOVERNORATE OF EGYPT WITH A SPECIAL REFERENCE TO ITS CONTROL IN PUPPIES BY DELTAMETHRIN AND IVERMECTIN MARIA ZAMORNEA, D. ERHAN, Ş.RUSU, NINA TĂLĂMBUȚĂ, O.CHIHAI, VIORICA COADĂ ESTIMATION OF VEGETAL EXTRACTS EFFICIENCY IN DOMESTIC BIRDS ECTOPARASITOSES TREATMENT AND PROPHYLAXIS
297
300
307
318
BIOCHEMICAL AND HAEMATOLOGICAL PROFILE IN THE ADVANCED GESTATION PERIOD OF COPPER DEFICIENT HOLSTEIN
AND BROWN SWISS CATTLE
Alina ANTON, Gheorghe SOLCAN, Vasile BOGHIAN, Nicolae HAGIU Faculty of Veterinary Medicine Iasi
Alley Mihail Sadoveanu nr.8; Iasi – 700489, Romania; antonclaraalina@yahoo.com
10 Holstein and 10 Brown Swiss cattle in advanced gestation period, clinically healthy, from a farm from Romania were divided into 2 groups according to breed (group 1 = Holstein, group 2 = Brown Swiss) with the aim of evaluating the copper status and correlating these status with haematological and biochemical profiles.Ceruloplasmin concentrations (the primary Cu‐containing component of the blood) have been considered as reliable indicators to copper status.During the protocol, no statistically significant differences were noted in the hematological and biochemical parameters in Holstein versus Brown Swiss cattle, remaining within their physiological adult reference range, except plasma ceruloplasmin.These were below cattle reference range for all 20 cattles. In our study, the values of plasma ceruloplasmin were significantly increased (P < 0,05) in Brown Swiss cattle (54.97 ± 15.62 mg/L) than Holstein cattle (40.60 ± 5.18 mg/L), probably due to genetic predisposition. Keywords: ceruloplasmin, copper, haematology, blood biochemistry, cattle
Copper is the rate – limiting element in the synyhesis of ceruloplasmin, a glycoprotein that is synthetized in the liver. Ceruloplasmin concentrations (the primary Cu‐containing component of the blood) have been considered as reliable indicators to copper status (Jain, 1993). Close correlation between plasma ceruloplasmine and copper concentration have been reported in many animal species in cluding sheep, cattle and horses (Arthington et al., 1996; Cerone et al., 1998). The aim of the present study was to determine the copper status and the correlation between these status and haematological and biochemical profiles. MATERIAL AND METHODS The present study was carried out on a private farm from Nord‐East of Romania. Blood samples were collected from 20 cattle in the advanced gestation period grouped by breeds (group 1 = Holstein, group 2 = Brown Swiss). The animals were clinically normal and free from any external, and internal parasites. They were fed with corn silage, concentrates and hay. The animals were supplemented with 250 g/day of a commercial mineral and vitamin mix. The basal diet was analyzed to contain 9 mg of copper/kg dry matter intake. Blood samples were collected from the coccygeal vein into heparinized vacutainers for plasma and uncoated vacutainers for serum. The samples were analysed for glucose, urea nitrogen (BUN), β‐hydroxybutyrate (β‐OHB), cholesterol, calcium (Ca), phosphorus (P), magnesium (Mg), alkaline phosphatase (PA), total protein (Pt), albumin (Alb), globulin (Gb), plasma ceruloplasmin (Cerlp) and plasma haptoglobin (Hapt). Serum levels analysis and plasma were performed in an automatic biochemical Cormay Accent 200.
7
Lucrări Științifice – vol 53 seria Medicină Veterinară
About 2 ml blood was sampled into small vacutainers containing a dried anticoagulant (EDTA‐K) and gently mixed for hematological parameter determinations. Haematological analyses included red blood cells (RBC), haematocrit (Htc), haemoglobin (Hb), mean cell volume (VEM), mean cell haemoglobin (HEM), mean cell haemoglobin concentration (CHEM), white blood cells (WBC) and number of platelets. The samples were analysed in an automated cell counter (Animal Blood Counter Vet) for complete blood count. Differential leukocyte count was performed microscopically on Giemsa stained blood film. Statistical analysis was conducted using SPSS 16 for windows. Breeds effect was examined using Student`s t‐Test. Mean values and standard deviations were calculated from individual values. The relationship between ceruloplasmin and haematological and biochemical parameters was calculated through Pearson correlation test. RESULTS AND DISCUSSION The values are discussed in relation with the published reference ranges for adult cattle. The mean (SE) values of RBC, Hb, Htc, VEM, HEM and CHEM at Holstein and Brown Swiss cattle in advanced gestation are shown in table 1. Regarding RBC, Hb, Htc, VEM, the most elevated values were observed in Brown Swiss cattle, but the differences were not statistically significant (P > 0.05). Pregnancy causes minor changes in RBC and WBC concentrations. As pregnancy advanced, erythrocyte number increased slightly (Wood and Quiroz‐Rocha, 2010). The lowest values of HEM (16,12 ± 1,23 pg) and CHEM (32,06 ± 1,39 %) have been observed in Brown Swiss cattle but the differences were not statistically significant (P > 0.05). The same situation was observed at number of platelets when Holstein cattle showed elevated values (315 ± 118,21 x 10³/µL) compared with Brown Swiss cattle (227,4 ± 91,84 x 10³/µL) but the differences were not statistically significant. During the entire study, the RBC , Hb, Htc, VEM, HEM, CHEM and platelets at Holstein and Brown Swiss cattle were placed in physiological limits for adult cattle. In the present study, Pearson correlation test did not show an association (P > 0.05) between ceruloplasmin values and RBC, Hb, Htc, VEM, HEM and CHEM.
Table 1. Mean (SE) values of RBC, Hb, Htc, VEM, HEM and CHEM at Holstein and Brown Swiss cattle
in advanced gestation
Cattle RBC
(x 106/µL) Hb
(g/dL) Htc(%)
VEM(fL)
HEM (pg)
CHEM(%)
Holstein 6,12±0,65 9,98±0,40 29,5±1,47 48,4±3,20 16,38±1,12 33,82±0,85Brown Swiss 6,53±0,63 10,42±0,3 32,64±1,39 50,2±3,34 16,12±1,23 32,06±1,39Normal values
for cattle (after Kramer,
2000)
5‐10 8‐15 24‐46 40‐60 11‐17 30‐36
The mean (SE) values of WBC, Lymph (lymphocytes), Mon (monocytes), Neutroph (neutrophils), Eos (eosinophils) at Holstein and Brown Swiss cattle in advanced gestation are shown in figure1. In the present study, mean values of WBC were within the adult reference range (4‐12 x 10³/µL) (Kramer, 2000).
8
Universitatea de Științe Agricole și Medicină Veterinară Iași
Regarding the number of monocytes there were observed higher values (0,38 ± 0,14 x 10³/μL) in Holstein cattle, compared with Brown Swiss cattle (0,26 ± 0,08 x 10³/μL), but the differences were not statistically significant. In the present study, the mean values of lymphocites were below cattle reference range 2,5‐7,5 x 10³/μL (Kramer, 2000) for the 2 groups, and the mean values of neutrophils were higher than cattle reference range 0,6‐4,12 x 10³/μL (Kramer, 2000). In the periparturient period, cows typically have an stress leukogram characterized by a neutrophilia, lymphopenia, eosinopenia, and monocytosis. Several studies have shown shifts in proportions of different lymphocyte populations at the time of parturition. These changes may be partly related to nutritional status and other health parameters, but pregnancy and lactation appear to have the primary effect (Torquist and Rigas, 2010) Pearson correlation test did not show an association between ceruloplasmin values and the values of leukogram.
Figure 1. Mean (SE) values of WBC, lymphocytes, monocytes, neutrophils and eosinophils at
Holstein and Brown Swiss cattle in advanced gestation
Table 2. Mean (SE) values of GGT, AST, PA, glucose, β‐OHB, BUN and cholesterol at
Holstein and Brown Swiss cattle in advanced gestation
Cattle GGT UI/L
AST UI/L
PAUI/L
Glucosemg/dL
β‐OHBmmol/L
BUN mg/dL
Cholesterolmg/dL
Holstein
42,12±12,39
81,07±07 32,4±17,43 51,28±6,33 0,82±0,1
8 13,48±3,0
7 138,98±27,2
3 Brown Swiss
30,38±11,30
57,20±6,56
25,04±10,23
55,16±10,01
0,98±0,28
8,73±3,31 118,12±32,5
3
Normal values for
cattle
15‐38 (after Smith, 2009)
43‐127 (after Smith, 2009)
0‐500 (after
Radostits, 2007)
45‐75 (after
Radostits, 2007)
0,35‐0,47 (after Smith, 2009)
6‐27 (after
Radostits, 2007)
65‐220 (after
Radostits, 2007)
In the present study the levels of AST, PA, glucose, BUN and cholesterol were consistent with the amounts in cattle and the differences between breeds were not statistically significant (P > 0.05). The mean (SE) values of GGT, AST, PA, glucose, β‐OHB, BUN and cholesterol at Holstein and Brown Swiss cattle in advanced gestation are shown in table 2. The higher values of GGT
9
Lucrări Științifice – vol 53 seria Medicină Veterinară
in Holstein cattle indicated cholestasis. The higher values of β‐OHB in Holstein cattle and lower values of glucose may suggest a subclinical ketosis. In the present study, Pearson correlation test did not show an association (P > 0.05) between ceruloplasmin values and GGT, AST, PA, glucose, β‐OHB, BUN and cholesterol. During the entire study, the total protein, albumin and globulin (figure 2) at Holstein and Brown Swiss cattle were placed in physiological limits for adult cattle and the differences between breeds were not statistically significant (P > 0.05). In the present study, Pearson correlation test did not show an association (P > 0.05) between ceruloplasmin values and Pt, Alb and Gb.
Figure 2. Mean (SE) values of total protein (Pt), albumin (Alb) ang globulin (Gb) at Holstein and Brown Swiss cattle in advanced gestation
The mean (SE) values of Ca, P and Mg at Holstein and Brown Swiss cattle in advanced gestation are shown in figure 3. In the present study phosphorus and magnesium at Holstein and Brown Swiss cattle were placed in physiological limits for adult cattle. The mean (SE) values of calcium were lower for Holstein and Brown Swiss cattle, than reference values and the differences between breeds were not statistically significant (P > 0.05).It has been shown that plasma calcium of 5 mg/dL reduce abomasal motility by 70 % and the strength of the contraction by 50 % (Daniel, 1983). Clearly a reduction in muscle contractility will lead to a decrease in dry matter intakes as rumen function decrease, leading to a severe negative energy balance. As a consequence, there is an increase in fat mobilisation that may result in fatty liver syndrome and ketosis. An excess of ketone bodies can further suppress appetite (Grummer, 1996). Thin cattle in a negative energy balance are unable to perform at maximum capacity in the herd (Anton and Solcan, 2008). Hypocalcaemia occurs when the rate of calcium uptake into the mammary gland for milk production is greater than that which is absorbed from the diet or resorbed from bone (Wilde, 2006) In the present study, Pearson correlation test did not show an association (P > 0.05) between ceruloplasmin values and Ca, P and Mg. Haptoglobin (protein that increases in acute inflammation) (figure 4) was within the adult reference range 0‐0,4 g/L (Radostits, 2007). Plasma haptoglobin showed the similar values at Holstein and Brown Swiss cattle. Pearson correlation test did not show an association between ceruloplasmin and haptoglobin values.
10
Universitatea de Științe Agricole și Medicină Veterinară Iași
Figure 3. Mean (SE) values of calcium (Ca), phosphorus (P) and magnesium (Mg) at Holstein and Brown Swiss cattle in advanced gestation
Figure 4. Mean (SE) values of haptoglobine (Hapt) at Holstein and Brown Swiss cattle in advanced gestation
In the present study, plasma ceruloplasmin (figure 5) were below cattle reference range 120‐200 mg/L (Radostits, 2007) for all 20 cattle. The diet containing 9 mg of Cu/kg of DM, was near by the inferior copper limits for adult dairy cattle (9‐18 ppm) (NRC, 2001). The improvement in nutritional status should improve milk production of the cattle as well as health performance of the animals (Anton and Solcan, 2008).
*Significant difference with Holstein cattle sampling. Figure 5. Mean (SE) values of ceruloplasmin (Cerlp) at Holstein and Brown Swiss cattle in advanced gestation Dashed lines represent reference values for adult cattle
Plasma ceruloplasmin activity is decreased by copper deficiency, the relative activity of this enzyme increases during infection and inflammation (Neve et al. 1988). Large quantities of Cu are deposited in the fetus during late gestation, and this can decrease Cu status of the dam if dietary Cu is low (Gooneratne and Christensen, 1989). The lowest levels of plasma ceruloplasmin were found in Holstein cattle 40,60 ± 5,18 mg/L but the differences were not
11
Lucrări Științifice – vol 53 seria Medicină Veterinară
statistically significant (P > 0.05) compared to Brown Swiss cattle. The reduction of digestive capacity in advanced gestation may limit copper intake for the cattle and fetus needs. Plasma ceruloplasmin may show a genetic difference in Cu absorption and metabolism postabsorption between Holstein and Brown Swiss breeds. The genetic difference may be related to the efficiency of dietary Cu absorption, the excretion of endogenous Cu, or amount of feed intake (Du et al., 1996).
CONCLUSIONS 1) Pearson correlation test did not show an association between ceruloplasmin and biochemical and haematological measurements in the advanced gestation. 2) Copper deficiency in Holstein and Brown Swiss cattle was not sufficient to cause hypochromic and microcytic anemia. 3) The diet containing 9 mg of Cu/kg of DM, did not meet the requirements of Holstein and Brown Swiss cattle in advanced gestation. 4) Plasma ceruloplasmin were below cattle reference range 120‐200 mg/L for all 20 cattle, but the lowest levels of plasma ceruloplasmin were at Holstein group 40,60 ± 5,18 mg/L.
REFERENCES 1. Anton A.,Solcan G., 2008 ‐ Body condition scoring with Romanian Black Pie dairy cow, Scientific
works, Univ. of Agr. Sci. And Vet. Med. Bucharest, C series, Veterinary Medicine, 53, p. 12‐15. 2. Arthington J.D., Corah L.R., Blecha F., 1996 ‐ The effect of molybdenum induced copper
deficiency on acute phase protein concentrations, superoxide dismutase activity, leukocyte numbers and lymphocyte proliferation în beef heifers inoculated with bovine herpes virus 1, J. Anim. Sci., vol. 74, p. 211‐217.
3. Cerone S.I., Sansinanea A.S., Streitenberger S.A., Garcia M.C., Auza N.J., 1998 ‐ The effect of copper deficiency on the peripheral blood cells of cattle, Vet. Res. Commun, 22, p. 47‐57.
4. Du Z., Hemken R.W., Harmon R.J., 1996 – Copper metabolism of Holstein and Jersey cows and heifers fed diets high in cupric sulfate or copper proteinate, J. Dairy Sci., vol. 79, p. 1873‐1880.
5. Gooneratne S.R., Christensen D.A., 1989 – A survey of maternal copper status and fetal tissue copper concentrations in Saskatchewan bovine, Can. J. Anim., vol. 69, p. 141‐150.
6. Grummer R.R., 1996 – Close‐up dry period: feeding management for a smooth transition. In: Proceedings WCDS, Red Deer, Alberta.
7. Jain N.C., 1993 – Essentials of veterinary hematology, Ed. Lea and Febiger, Philadelphia, p. 173‐175.
8. Kramer J.W., 2000 ‐ Normal hematology of cattle, sheep and goats. In: Schalm’s veterinary hematology. 5th ed. Philadelphia: Lippincott Williams and Wilkins, p. 075‐84.
9. National Research Council, 2001 ‐ Nutrient requirements of dairy cattle. 7th rev. ed. Natl. Acad. Sci. Washington, D.C., p. 236‐267
10. Radostits O.M., Gay C.C., Blood D.C., Hinchcliff K.W., 2007 ‐ Veterinary Medicine. A textbook of the diseases of cattle, sheep, pigs, goats and horses, Ed. Saunders W.B. Co.,Philadelphia, 10th ed., p. 1707‐1732.
11. Smith B.P., 2002 ‐ Large animal internal medicine 3th. ed. Mosby, London, Philadelphia, Sydney, Toronto, p. 783‐786.
12. Wilde D., 2006 – Influence of macro and micro minerals in the peri‐parturient period on fertility in dairy cattle, Animal Reproduction Science, vol. 96, p. 240‐249.
13. Wood D., Quiroz‐Rocha G.F., 2010 – Normal hematology of cattle, In: Schalm’s veterinary hematology. 6th edition, Blackwell Publishing, Iowa, p. 829‐835.
14. Tornquist S., Rigas J., 2010 – Interpretation of ruminant leukocyte responses, In: Schalm’s veterinary hematology. 6th edition, Blackwell Publishing, Iowa, p. 307‐320.
12
HISTOLOGICAL AND IMMUNOHISTOCHEMICAL STUDIES OF THE BUCK'S PINEAL GLAND DURING LIGHT AND DARK PERIODS
Attia, H.F and Mazher, K Department of Histology and Cytology, Faculty of Veterinary Medicine,
Benha and Beni‐Suef Universities Corresponding author: Hossam Attia, Benha University. Egypt.P.O. 13736
Abstract: the present investigation was conducted on the pineal organs of 12 healthy bucks. Sixth samples collected during dark period (at mid night) while the other six collected during light period (at noon).The samples were processed and prepared for light and electron microscopic examination. The pineal organ of bucks was surrounded by a thin fibrous capsule, the pia matter, while the parenchyma was supported by extensive reticular network.The parenchyma of the gland was formed of clusters or groups of pinealocytes intermingled with astroglia cells. Bundles of unmyelinated nerve fibers were noticed in the organ. During dark period the pinealocytes were large in size with finely granular cytoplasm containing well developed rER, mitochondria and many secretory granules. Long branched cytoplasmic processes arised from the pinealocytes to terminate near blood vessels or synapse with a nerve. The pinealocytes reacted positively with antimelatonin antibodies. During the light period the pinealocytes appeared smaller in size with clear non granular cytoplasm. The pinealocytes ahowed a very slight reaction to the antimelatonin antibodies.
INTRODUCTION During the last few years, the study of the pineal gland (epiphysis cerebri) attracts the attention of many authors at different aspects of biological sciences specially the histologists and the physiologists. Historically, the location of the pineal gland deep in the brain suggested to the philosophers that it is a mystery gland with myth, superstition and metaphysical theories surrounding its perceived function. Descartes (2002&2003) called it the seat of the soul. He believed that the gland is the point of connection between the intellect and the body. The pineal gland is occasionally associated with the sixth chakra (also called Ajna or third eye chakra in yoga) or sometimes seventh chakra (crown). It is believed to be a dormant organ that can be awakened to enable telepathic communications (Uz, et al , 2003). Arendt and Skene (2005) discovered that melatonin, the most potent compound then known to lighten frog skin, was present in highest concentration in the pineal body and its production is stimulated by darkness and inhibited by light. Histologically, the pineal gland of rat, pig, fish, bird, rabbit and hamster is thoroughly studied by Ferreira‐Medeiros, et al (2007), Przyblyska‐Gornowicz and Lewczuk (1997), Hafeez (2005), Ueck (1973), Romijn (1973) and matsushima, et al (1990) respectively while that of goat not yet investigated. Our study aimed to elucidate the light and electron microscopic pictures of pineal gland of the buck beside the immunohistochemical localization of melatonin in the gland during dark and light periods.
MATERIALS AND METHODS Twelve healthy bucks aging 10‐12 months‐old were subjected to the present investigation. The animals were subjected to a photoperiod of 12 hours dark and 12 hours light from rearing up to the time of slaughtering. Six animals were sacrificed at midnight (at 12 O'clock) while the
13
Keywords: buck, pineal gland, histology, immunostochemistry
Lucrări Științifice – vol 53 seria Medicină Veterinară
other six were sacrificed at noon (at 12 O'clock). The skull is opened carefully and the whole brain is taken, then the cerebral hemispheres were gently removed and excluded while the remained part was sagitally sectioned through the pineal body then quickly put into 20% neutral buffered formalin. After fixation the specimens were processed to obtain histological sections of about 4‐6 micrometers‐thick to be stained with hematoxylin and eosin, Gomori reticulin method, silver impregnation technique and indirect immunoperoxidase antiperoxidase PAP unlabelled antibody method using STAT polyclonal kits from diagnostic Products Corporation, Los Angelos, USA. The above mentioned methods were applied as outlined by Drury and Wallington (1980) and Bancroft and Steven (1995).
For electron microscopic examination, small pieces 1mmX1mm of the collected specimens were fixed in 3% glutraldhyde in 1M phosphate buffer (pH=7.3) for 24 hours then post fixed in 1M cold phosphate buffered 1% osmium tetroxide (pH=7.3) for 3 hours, rinsed in phosphate buffer then dehydrated (Hayat,1986). Ultra thin sections were obtained and mounted on cupper grids then stained with uranyl acetate and lead citrate (Reynolds, 1965) to be examined by Joel 100 CX transmission electron microscope in the unit of electron microscopy, Assuit University.
RESULTS The pineal gland was covered by a thin fibrous capsule, the pia matter, from which very short septa penetrate the gland. Extensive network of reticular fibers were noticed among the parenchymatous elements (Fig.1). The parenchymal cells were arranged in clusters, columns, rows or irregular groups permeated by many blood capillaries (Fig.2). Pineal sands, a small calcified dark patches, also noticed in the pineal parenchyma. Bundles of unmyelinated nerve fibers run in different directions in the parenchyma of the gland supported by glia cells (Figs.3&4). The parenchymal cells took different characteristic features according to light or dark periods. During dark period (at midnight) The gland appeared highly vascularized and the blood vessels became engorged with blood. The pinealocytes appeared large polyhedral cells with faintly stained and finely granular cytoplasm (Fig.5). The nuclei appeared large spherical, vesicular and somewhat eccentrically situated with a prominent nucleolus. The pinealocyte showed multiple (4‐6) branched cytoplasmic processes which either terminated in flattened dilatations adjacent to blood capillaries or synapses with nerve fibers (Fig.6). The pinealocyte appeared large and slightly electron dense cell containing a large euchromatic nucleus with a prominent nucleolus. The cytoplasm contained a well developed rough endoplasmic reticulum, Golgi complex, many rounded and filamentous mitochondria and numerous free ribosomes. Secretory granules of variable shapes and sizes as well as fat droplets were also noticed (Fig.7). By using indirect immunoperoxidase technique the pinealocytes showed a strong positive reaction to the antimelatonin antibodies (Fig.8). The astroglial cells appeared elongated or oval cells irregularly distributed between the pinealocytes. They had oval darkly stained centrally situated nuclei in a scant cytoplasm (Fig.5). These cells possessed numerous short and branched cytoplasmic processes (Fig.6).
14
Universitatea de Științe Agricole și Medicină Veterinară Iași
During the light period (at noon) The pinealocytes became smaller in size , polyhedral in shape and the cytoplasm became lighter in stain and non granular (Fig.9). The nuclei remain spherical, vesicular and eccentric with a prominent nucleolus. The blood vessels became smaller in caliper and not engorged with blood. The pinealocytes appeared more electron lucent, free from secretory granules and the nucleus became slightly irregular in outline. The profiles of the other organelles remained as the previous stage (Fig.10). By using the indirect immunohistochemical technique the pinealocytes showed a very faint or slight reaction to the antimelatonin antibodies (Fig.11).
DISCUSSION The epiphysis cerebri has a very interesting histological structure based on its unique anatomical position. It is generally accepted that the pineal body develop as an upward growth from the diencephalon to which it is connected by a short stalk (Ferreira‐Medeiros et al. 2007 and Borregon et al. 1997). The gland under investigation was covered by a thin fibrous capsule, the pia matter, from which short septa penetrate the gland as mentioned by Hafeez (2005); Kus et al. (2004) and Reus et al. (1990). The parenchymatous elements of the gland were supported by an extensive network of reticular fibers (Borregon et al. 1997). Beside its role as a protective coat, the fibrous stroma carry blood vessels, lymph and nerve supply of the gland (Kus etal. 2004). There is a general agreement that the histological picture of the pineal parenchyma differs according to light or dark period to which the individual exposed (Ferreira‐Medeiros et al.2007; Kus et al. 2004 and Matsushima et al 1990). The authors stated that the gland becomes well developed with a pronounced proliferation and activity of its parenchymal cells during dark period while during light, the activity of the gland is greatly decreased. In this respect, our study revealed that the pinealocytes of the glands collected during dark period showed a marked proliferation as they become larger in size with finely granular cytoplasm together with a marked congestion of the pineal blood vessels. The above mentioned histological signs indicate a higher activity of the organ (Macchi and Bruce 2004). Moreover, the pinealocytes showed a well developed rough endoplasmic reticulum, Golgi complex as well as many mitochondria as mentioned by Ueck (1973) and Oksche et al. (1972). The authors explained the role of each of these organelles in the secretory activity of the cell. The presence of electron dense secretory granules as well as lipid droplets in the cytoplasm of pinealocytes of buck at dark periods is an absolute sign of the increased secretory activity of the gland as explained by Uria et al. (1992) and Owman and Rudeberg (1970). The pinealocytes of buck showed long and branched cytoplasmic processes which either terminate in a flat dilatation adjacent to blood capillaries or synapses with unmyelinated nerve. Similar observations were also reported by Reuss et al. (1990) and Oksche et al. (1972). The latter explained the role of cytoplasmic processes in the secretion on the other hand Mutsushima et al. (1990) explained them as stimuli receivers. Both opinions could be met in the buck pineal where the cytoplasmic processes joining blood capillaries play a role in secretion while that synapses with nerve act as stimuli receivers. The immunohistochemical reaction in our study augments the electron microscopic findings and indicates that the buck pinealocytes produce considerable amount of melatonin during darkness as stated by most researchers studying the pineal gland. Alexandr (1970) and Moore et al. (1967) mentioned that the production of melatonin by the pineal gland is stimulated by
15
Lucrări Științifice – vol 53 seria Medicină Veterinară
darkness and inhibited by light. Photosensitive cells in the retina detect light and directly signal the suprachiasmatic nucleus and extending it to the 24 hours clock. Fibers from SCN to the paraventricular nucleus which relay the circadian signals to the spinal cord and out via sympathetic system to the superior cervical ganglia and from these to the pineal gland. Barrenefxe et al. (2004) and Ekstron and Meissl (2003) stated that melatonin is synthesized from amino acid tryptophan within the pinealocytes during darkness and it is said to have neurological properties for resynchronization of sleep and circadian rhythms disturbances. In the periphery, melatonin is also involved in the regulation of several complex cycles as seasonal reproduction, body weight and energy balance. Arendt and Skene (2005) decided that exogenous melatonin has sleeping‐inducing and temperature‐lowering effects during biological daytime and when suitably timed it will shift the phase of human circadian clock (sleep, endogenous melatonin, core body temperature and cortisol) to earlier (advance phase shift) or later (delay phase shift) times. As mentioned by Borregon et al. (1993) the astroglial cells appeared oval or elongated with short and branched cytoplasmic processes. The authors suggest a supportive role of the glial cells while Ekstron and Meissl (2003) explained the role of these cells in transmission of nerve impulses between pinealocytes. The presence of calcified dark patches of variable quantities is also recorded in most species especially at the age of puberty till senility and called corpora arenacea (Baconnier et al. 2002). Chemical analysis of these patches shows that they are composed of calcium phosphate, calcium carbonate, magnesium phosphate and ammonium phosphate (Bocchi and Valdre 1993). The pinealocytes of the samples collected during light periods showed a marked decrease in cell size and absence of secretory granules which reflected on the very weak immunohistochemical reaction as stated by Barrenefxe et al. (2004), Ekstron and Meissl (2003) and Alexandr (1970). The latter refers to the pineal gland during light as a gland in resting stage. The similarity of the cytoplasmic organelles between the pinealocyte of dark and light samples indicate that the pinealocyte in light is an active cell but wait a nerve stimulus to synthesize and secrete melatonin (Matsushima et al. 1990).
REFERENCES Alexandr,J., 1970: The pineal gland. Endeavour. 29(108): 144‐148. Arendt,J. and D.Skene, 2005: Melatonin as a chronobiotic. Sleep Med. Rev. 9(1): 25‐39 Baconnier,S., S. Lang, M. Polomska, B. Hilczer, G. Bekcovic and G. Meshulam, 2002: Calcite microcrystals in the pineal gland of the human brain (physical and chemical studies). Bioelectromagneticc 23(7): 488‐495. Bancroft and Steven, 1996: Theory and practice of histological techniques. 4th Ed., Churchill‐Livingstone, Edinburgh, London, Melborne, New York Barrenefxe,J., P. Delagorange and J.Martinez, 2004: Physiological and metabolic functions of melatonin. J. Physiol. Biochem. 60(1): 61‐72 Bocchi,G. and G.Valdre, 1993: Physical, chemical and mineralogical characterization of carbonate‐hydroxyapatite concretions of the human pineal gland. J. Inorg.. Biochem. 49(3): 209‐220. Borregon,A., J. Boya, L. Calvo and F. Lopez‐Munoz, 1993: Immunohistochemical studies of the pineal glial cells in the postnatal development of the rat pineal gland. J. Pineal Res. 14(2): 78‐83 Descartes, R., 2002: The Passion of The Soul" excerpted from "Philosophy of The Mind" Chalmers, D. New York: Oxford University Press, Inc. Descartes, R., 2003: Treatise of Man. New York, Prometheus books.ISBN. Drury R. and E. Wallington, 1980:Carleton's histological technique. 4th Ed. Oxford Univ. Press. London, New York and Toronto.
16
Universitatea de Științe Agricole și Medicină Veterinară Iași
Ekstrom,P. and H. Meissl, 2003: Evolution of photosensory pineal organs in new light: the fateneuroendocrine photosensors.Philos.trans.Soc. Lond. Biol.Sci. 358(1438): 1679‐1700. Ferreira‐Medeiros,M., C. Mandarim and E. Correa‐Gillieron, 2007: Pineal gland postnatal growth in rat revisited. Anat. Histol. Embryol. 36(4): 284‐289. Hafeez,M., 2005: Light microscopic studies on the pineal organ in teleost fishes with special regard to its function. J. Morph. 134(3): 281‐313 Hayat, M, 1986: Basic techniques for transmission electron microscopy. 1st Ed. Academic press, Inc. Florida Kus,I., M. Sarsilmaz, O. Ozen, A. Turkoglu, H. Pekmez, A. Songur and H. Kelestimur, 2004: Light and electron microscopic examination of pineal gland in rats exposed to constant light and constant darkness. Neuroendocrinol. Lett. 25(2). Macchi,M. and J. Bruce, 2004: Human pineal physiology and functional significance of melatonin. Front. Neuroendocrinol. 25 (3‐4): 177‐195 Matsushima,S., Y. Sakia and Y. Hira, 1990: Effect of photoperiod on pineal gland volume and pinealocyte size in the chinease hamster (cricetulus griseus). Am. J. Anat. 187(1): 32‐38 Moore,R., A. Heller, R. Wurtman and J. Axelrod 1967: Visual pathway mediating pineal response to environmental llight. Science, 155(759): 220‐223. Osche,A., H. Kirschstein, H. kobayashi and D. Farner, 1972: Electron microscopic and experimental studies on the pineal organ of white crowned sparrow, Zonotrichia leucophrys gambelii. Z.Zellforsch.Mikrosk. Anat. 124(2): 247‐274 Owman,C. and C. Rrudeberg, 1970: light, fluorescence and electron microscopic studies on the pineal gland of pike, Esox lucius L, with special regard to 5‐hydroxytryptaminase. Z.Zellforsch.Mikrosk. Anat.107(4): 522‐550. Przyblyska‐Gornowicz,B. and B. Lewezuk, 1997: cytoplasmic dense bodies in pig pinealocyte during postnatal development: Quantitative and ultrastructural study.Folia Morphol. (Warsz). 56(1): 13‐21. Reus,S., C. Spies, H. Shroder and L. Vollrath, 1990: The aged pineal gland: reduction in pinealcyte number and adrenergic innervation in male rats. Exp. Gerontol. 25(2): 183‐188 Reynolds, E., 1965: The use of lead citrate at high pH as an electron opaque in electron microscopy. J. Cell Biol., 26: 208‐215 Romijn,H., 1973: Structure and innervation of the pineal gland of the rabbit, An electron microscopic investigation. Z.Zellforsch.Mikrosk. Anat. 141(4): 545‐560. Ueck,M., 1973: fluorescence and electron microscopic studies of the pineal body in different species of birds. Z.Zellforsch.Mikrosk. Anat. 137(1): 37‐62 Uria,H., I. Antolin, D. Tolivia, M. Rodrigues and P. Menendes, 1992: the pineal gland of the trumpet‐tailed rat (Octodon degus).J. pineal Res. 13(4): 174‐183. Uz,T., M. Akhisaroglu, R. Ahmed and H. Manev, 2003: The pineal gland is critical for circadian period 1‐expression in striatum and for circadian cocaine sensitization in mice. Neuropsychopharmacology 28(12): 2117‐23. LIST OF FIGURES Figure (1) : A photomicrograph of the pineal gland of a buck showing a thin capsule © and extensive network of reticular fibers supporting the pineal parenchyma. Gomori reticulin method, X 400 Figure (2) : A photomicrograph of the pineal gland of a buck showing pinealocytes arranged in clusters or irregular groups permeated by blood vessels (V). Note, the pineal sand (arrow). Hx&E stain, X, 200 Figure (3) : A photomicrograph of the pineal gland of a buck showing bundles of unmyelinated fibers (F) run in different directions. Hx&E stain, X,200 Figure (4) :An electron micrograph of the pineal gland of a buck showing cross sections of unmelinated axons (F). Uranyl acetate and lead citrate stain, X10000 Figure (5) : A higher magnification of the pineal gland of a buck during dark period showing pinealocyte (arrow) is large polyhedral cells containing large oval to spherical nucleus. The gland contains blood vessels (V) engorged with blood. Hx&E stain, X1000 Figure (6) : A photomicrograph of the pineal gland of a buck during dark period showing pinealocyte (P) with its long and branched cytoplasmic processes which terminate in blood vessel (V) or synapsed with a
17
Lucrări Științifice – vol 53 seria Medicină Veterinară
nerve (N). Note astroglia (A) with its short processes. Silver impregnation technique (Cajal's method). X1000 Figure (7) : An electron micrograph of the pinealocyte of a buck during dark period showing numerous endoplasmic reticulum ®, mitochondria (M), secretory granules of variable shapes (arrow) and lipid droplets (V). Uranyl acetate and lead citrate stain, X10000 Figure (8) : A photomicrograph of the pineal gland of adult a buck dark period showing a strong reaction (dark brown) in the pinealocytes. Indirect immunoperoxidase technique. X400 Figure (9) : A photomicrograph of the pineal gland of a buck during light period showing pinealocytes (arrow) with clear non granular cytoplasm. Hx&E stain, X1000 Figure (10) :An electron micrograph of the pinealocyte of a buck during light period showing many mitochondria (M), endoplasmic reticulum ®, and lipid vacuoles (V).Note the absence of secretory granules. Uranyl acetate and lead citrate stain, X10000 Figure (11) : A photomicrograph of the pineal gland of a buck during light period showing very faint reaction in the pinealocyte. In direct immunoperoxidase technique. X400
18
Universitatea de Științe Agricole și Medicină Veterinară Iași
19
COMPARATIVE STUDY OF VASCULAR ARTERIAL REACTIVITY AT
SEVERAL MAMMAL SPECIES: 1. THE REACTIVITY OF ARTERIAL SMOOTH MUSCLES AT THE VASOCONSTRICTOR AGENTS ANTIDIURETIC HORMONE
(VASOPRESSIN)
S. Beschea‐Chiriac University of Agricultural Sciences and Veterinary Medicine, Iasi
Faculty of Veterinary Medicine
Vascular reactivity is one of the three pillars on which lies the regulation of arterial pressure in living organisms. Arterial pressure is one of the main determinants of the activity state of various organs and systems both in healthy and in pathologically‐altered states. The present study aims toward identifying similarities and differences between the resistance arteries belonging from various mammal species that are most involved in veterinary practice: rats, cats, dogs and horses. The arterial fragments prelevated from animals dead due to various clinical and traumatic conditions unrelated to vascular pathology were normalized using a newly‐introduced system of quantification, the force index system. This has been calculated using the wet‐weight parameter and the force generated after administration of various pharmacological agents that cause vasoconstriction. The artery fragments were fitted in organ baths using the Krebs‐Henseleit saline, thermostated at 37° C and bubbled with a mixture of 95% O2 and 5%CO2. Vascular endothelium was either kept or removed using gentle rubbing with moist filter paper. Control of endothelial removal was made both functionally, using carbachol (synthetic derivative of acetylcholine) and microscopically, after testing. The force generated was measured using isometric force transducers coupled to a computerized acquisition system. The pharmacological vasoconstricting agents used were phenylephrine (synthetic derivative of epinephrine), KCl (potassium chloride 40‐80 mM, as depolarizing agent) angiotensin II, and vasopressin. The results were statistically investigated using the t‐test and ANOVA testing. The preliminary results show a dependence of the force generated an the amount of muscle present in the various species from which the arteries were taken, a specifically increased response of feline‐derived arteries to angiotensin and a specifically increased response of canine‐derived arteries to vasopressin. These results will be used as controls for further testing in various pathological conditions and for various other pharmacological agents used in the therapy of vascularly‐induced pathological states.
Key words: vascular, reactivity, arterial, vasoconstrictor agent
The aim of this study is to investigate the most common modifications encountered in the veterinary practice in the vascular arterial reactivity that could be involved in the pathogenesis of various animal species. We also wish to make a comparative investigation of the vascular reactivity at the arterial segments collected from different mammal species the veterinary pathology has most frequently to deal with, segments which are histologically and functionally similar. The investigation of the methods that are at the basis of the arterial tonus adjustment and of the metabolism of the arterial smooth muscle fiber relied in the last two decades on the very well known isometric transducers pattern and on that of the annular preparation of different arteries. The arterial duct of election used for these types of investigations is the rat aorta, as
20
Lucrări Științifice – vol 53 seria Medicină Veterinară
it combines most of the stability, accessibility, disposability and controllability conditions required for a trustworthy investigation. The price is also an important criterion in this matter. Although the above mentioned pattern is so very well known, still, the rat is not a perfect model in what the cardiovascular modeling is concerned; it is not similar with the human being and even less with other mammals. This experimental model was used in studies as from half century ago [3]. Thus fragments of arteries collected from dogs, cats and horses were used as subject to an experimental comparative investigation with standardized thoracic aorta rings taken from Wistar rats. MATERIALS AND METHOD The reactivity of the arterial rings was measured in terms of both absolute force, measured as force index (the force in mN of the preparation reported at its weight in mg) and relative reaction towards a standardized witness. Also, where possible (considering the preparations availability) curves dose/effect were made, involving the majority of the known vasorelaxing and vasoconstrictor substances that are pharmacologically well characterized. The comparative study was made on similar arteries in what their dimensions are concerned, being part of the resistance segment, in this situation branches from the gastric coronary artery or the superior mesentery which had similar dimensions: maximum length: 2 mm, � = 1 mm, weight 10‐15 mg. The force of contraction was quantified in N/mg wet weight.(4) The organ parts were taken from the Medical Clinique and the Surgery Clinique from the Faculty of Veterinary Medicine, from dead animals that were not subject of legal euthanasia nor had affections with vascular implications. [8] After dissection the vessels were exsanguinated, washed in a solution of physiological salt, sectioned in fragments of 5‐10 cm and then put into Krebs‐Henseleit serum (prepared according to the formula) and transported in maximum 30 minutes to the place of the experiment. The aorta fragments were fixated through a metallic serfina on the bottom of the isolated organ baths, and the ring tensioned through the verniers of the tensiometrical stamps to an initial tension of 100 mN. The vascular endothelium was removed by gentle rubbing with damp filter paper whenever the experimental characteristics required it. The presence of the functioning vascular endothelium was pharmacologically verified using carbachol and through direct microscopy. The aorta rings were set in organ baths containing 4 ml of Krebs‐Henseleit physiological salt, (composition (mN): NaCl 118; KCl 4.7; 2.52; MgSO4 1.64; NaHCO3 24.88; KH2PO4 1.18; glucose 5.55), thermostated at 37°C and bubbled with carbogen (a mixture of 95% oxygen and 5% carbon dioxide). Isometric force transducers connected to a computerized system for data acquisition were used for detecting the contractions of the vascular smooth muscles ... The preparations were allowed to equilibrate for 60‐90 minutes under a rest tension of 100 mN. The aorta rings were afterwards precontractated with phenylephrine (10‐7 – 10‐6)M and K+ (40‐70 mM) and treated with carbachol (10‐6M) for releasing endothelial NO [6]. The absolute magnitude of the contractions was of 175 ± 25 mN for the phenylephrine (10‐6 M) and K+ (40‐70 mM)
21
Universitatea de Științe Agricole și Medicină Veterinară Iași
RESULT AND DISCUTION The effects of administering antidiuretic hormone (Vasopressin) on the contractility of the arterial preparations The ADH hormone, also known as Vasopressin, is an essential neuropeptide for the cardiovascular homeostasis. Vasopressin was among the first peptide hormones ever described and it is clinically used for more than five decades, especially in treatment of diabetes insipidus and of upper gastrointestinal bleeding due to esophageal varices. Vasopressin is also more and more often used in therapeutic management of shock, whether it is septic or vasodilator due to different reasons. The ADH is a nonapeptide having a disulfide bridge between two cysteinic amino acids. It is synthesized in the paraventricular and supraoptic nucleuses of the hypothalamus, transported coupled to the neurophysins along the hypothalamohypophyseal tract to the neurohypophysis and stored in granules. The effect of this hormone is achieved through two types of receptors, V1, found in the blood vessels (on the vascular smooth muscle) and which mediates the vasoconstriction through a cascade of mediators involving phospholipase C and release of calcium ions from intracellular stores through the inositol‐phosphate system. The V2 receptors are located in the distal renal tubule and kidney collecting tube. Their effect is to stimulate the expression of aquaporines (water channel proteins) in the tubule, thus allowing re‐uptake of water and antidiuretic effect. In normal conditions, AHA has little effect on arterial pressure and the doses at which its vasoconstrictor effect becomes noticeable are at least 10 times higher than normal plasmatic concentrations. However, in conditions of hypotension, its plasmatic concentration increases greatly and its vasoconstrictor effect allows keeping a high arterial pressure in the initial period.
15001550160016501700175018001850190019502000
3300 3800 4300 4800 5300
timp (sec)
Fort
a (m
gF)
Figure no. 1 – Characteristic aspect of vasopressin contraction on the rat aorta
But as the ADH neurohypophyseal reserves lessen, its plasmatic concentration decreases and its benefic effects – those of keeping the arterial pressure at quasi‐physiological levels are fading.
22
Lucrări Științifice – vol 53 seria Medicină Veterinară
The administrations in isolated preparations were made using the Desmopressin Acetate (Ferring) preparation in form of ampoules of 4 μg/mL. The preparation is a synthetic analogue of the natural 8‐arginine‐vasopressin hormone, under the form of arginine‐vasopressin‐monoacetate‐trihydrate. The doses were administered starting from 10‐12 M to 10‐8 M. In the rat aorta preparations and in splanchnic arteries from cat, dog and horse, vasopressin produced a tonic contraction, with the appearance of a descending plateau over a period of 10‐15 minutes (Fig. 1). The force indices obtained at the vasopressin contraction are presented in Table no. 1
Table no. 1
Force index after administration of ADH 10‐8 M
Animal FIRat 3,9 ± 1,25Cat 4,1 ± 0,75Dog 6,5 ± 1,5Horse 7,1 ± 0,89
Regarding the force produced, this is the most powerful of all preparations administered, except for the �‐adrenergic agonist phenylephrine. From the dose‐effect curve configuration (Fig. no 32) it can be seen that very low doses (10‐12 M – physiological) produce little contractile effects, while with higher (pharmacological) doses, from 10‐10 M, the contractile effects are close to maximum, having a curve with biphasic aspect. The curve aspect suggests the presence of quantum effects at the V1‐type receptors.
Figure no. 2 –Vasopressin dose‐effect curve in endothelized preparations
from various species Vasopressin contraction has a number of particular features concerning the dynamic. The contractile plateau lasts for only 10‐15 minutes and after that it ceases and a new administration no longer produces the original effect (possibly tachiphylactic phenomena).
0
1
2
3
4
5
6
7
8
12 11 10 9 8
Vasopressin log dose
FI (m
N/m
g)
Rat Cat Dog Horse
23
Universitatea de Științe Agricole și Medicină Veterinară Iași
Figure no. 3 –Vasopressin contraction force after administration of 10‐10 M desmopresin. The differences between endothelized and de‐endothelized preparations do not exhibit statistic
significance It also should be said that in dog’s case, the effect was significantly stronger, considering the fact that the thickness of the muscular layer was smaller than that of the horse’s, which leads to the assumption that dogs have a particular reactivity in what the vasopressin mediation is concerned (Fig. no 3).
CONCLUSION 1. Vasopressin reactivity produces the highest force, except for the �‐adrenergic agonist
phenylephrine. 2. From the dose‐effect curve configuration it can be seen that very low doses (10‐12 M
– physiological) produce little contractile effects, while with higher (pharmacological) doses, from 10‐10 M, the contractile effects are close to maximum, having a curve with biphasic aspect. The curve aspect suggests the presence of quantum effects at the V1‐type receptors.
3. In dog’s case the effect was significantly stronger, considering the fact that the thickness of the muscular layer was smaller than that of the horse’s, which leads to the assumption that dogs have a particular reactivity in what the vasopressin mediation is concerned.
BIBLIOGRAPHY 1. Armstead WM, Lippton HL, Hyman AL, Kadowitz PJ., 1984 ‐ Analysis of adrenergic responses
in the mesenteric vascular bed of the cat; evidence that vascular beta 2‐adrenoceptors are innervated. Can J Physiol Pharmacol. 62(12):1470‐8.
2. Beşchea Chiriac Sorin, Serban DN., 2001 ‐ Mechanisms involved in the vascular action of phenamyl, Lucr. St. vol. 44., USAMV Iaşi, p. 151‐159;
3. Beznak M., 1956 ‐ Hemodynamic changes following aortic constriction in normal and in hypophysectomized rats. ‐ Can J Biochem Physiol., 34(4):791‐8.
4. Guimarães S. Moura D., 2001 ‐ Vascular Adrenoceptors: An Update ‐ Pharmacol Rev. 53: 319‐356.
0
1
2
3
4
5
6
7
8
9
1 2 3 4
FI
Rat Cat Dog Horse
24
Lucrări Științifice – vol 53 seria Medicină Veterinară
5. Haulica I, Bild W, Mihaila CN, Ionita T, Boisteanu CP, Neagu B., 2003 ‐ Biphasic effects of
angiotensin (1‐7) and its interactions with angiotensin II in rat aorta. ‐ J Renin Angiotensin Aldosterone Syst. 4(2):124‐8
6. Jiang H, Halayko AJ, Rao K, Cunningham P, Stephens NL., 1991 ‐ Normalization of force generated by canine airway smooth muscles. ‐ Am J Physiol. 260(6 Pt 1):L522‐9.
7. Moncada S., Palmer R.M.J., Higgs E.A., 1991 ‐ Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol. Rev., 43: 109‐142
8. Rozenfeld V, Cheng JW., 2000 ‐ The role of vasopressin in the treatment of vasodilation in shock states ‐ Ann Pharmacother. 34(2):250‐4.
9. * * * LEGE nr.471 din 9 iulie 2002 – Buletinul Oficial al României, privind aprobarea Ordonantei Guvernului nr. 37/2002 pentru protectia animalelor folosite în scopuri stiintifice sau în alte scopuri experimentale.
10. Holmes Cheryl, Patel B. M., Russell J. A. Walley K.R., 2001 ‐ Physiology of Vasopressin Relevant to Management of Septic Shock – Chest. 120;989‐1002
25
MORPHOCLINICAL ASPECTS OF BABESIOSIS IN HORSES
Boghian V., Mălăncuş R.N., Acatrinei D., Pașca S.,
Anton Alina, Solcan Gh. Faculty of Veterinary Medicine Iasi
Alley M. Sadoveanu no. 8 vboghian@yahoo.com
Abstract: In 7 horses with clinical signs of cortical syndrome in the inhibition phase, subicter and dark urine were performed blood counts (HLG), cytomorphological examination of the blood smear (May Grunwald Giemsa stained), biochemical profile and macroscopic examination of the internal organs. Blood count revealed normochromic normocytic regenerative anemia with a low number of red blood cells (5.3 x103/mm3). Blood biochemical examination revealed hepato‐biliary insufficiency (ALT = 88.9 IU / L, ALP = 222.7 IU / L) and renal insufficiency (BUN = 35.7 mg / dl = 2.8 mg CRTN / dL). Disease has been confirmed by observing endoglobular merozoits of B. equi and in morphopathological examination were found bleeding points in the heart and splenomegaly.
Keywords: babesiosis, equine, B. equi Babesiosis is a hemosporidiosis also called piroplasmosis produced by sborozoa from Babesiidae family disseminated by hematophagous mites from Ixodidae family, also known as tick. Each species of Babesia species corresponds to a tick. In horses the disease is caused by B. equi, B. cabali, Nutallia equi and newer by B. canis. The disease is characterized by the modified general condition, anemia and nervous manifestations predominantly represented by cortical inhibition, which leads to death unless etiological treatment is applied. (3, 4). In this paper we present some morphoclinical aspects of babesiosis in horses that are useful to guide diagnosis, so etiotropic treatment can be applied.
MATERIAL AND METHOD Observations were made on seven horses (4 stallions, two mares and a horse) aged between two and eight years presented to the Medical Clinic of the Faculty of Veterinary Science from Iași. Diagnosis was established by collating data obtained at clinical examination with some laboratory data. Such was performed blood counts (CBC), biochemical profile, and cytomorphological blood smear examination using May Grunwald Giemsa staining. After the performed treatment, 6 animals were cured and one died because of complications (pulmonary edema). In this animal was performed a macroscopic examination of the internal organs. RESULTS AND DISCUSSION Guideline the diagnosis to babesiosis started from a similar clinical environment in all seven cases: loss of appetite, signs of cortical inhibition (tolerance, adynamie, drowsiness) and rectal temperature exceeding the upper limit of reference (39.50 C). The mucous membranes had a subicteric character, cyanotic appearance and the urine was brown (fig. 1)
26
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 1.
The subicteric mucous membrane and brown urine Haematological examination results are shown in Table 1 and 2.
Table 1.
Haematological parameters in horses with babesiosis
Blood Paramet
ers
Erythrocytes
Hb Ht
Leuco‐cytes
Blood smear Mature neutro‐phils
Young neutro‐phils
Eosino‐phils
Bazo‐phils
Monocyte
Limphocyte
Measurement units
mil/μl g/dl
% mii/μl
% % % % % %
Reference
6‐12 10‐18
32‐48
6‐12
30‐75
0‐1 1‐10 0‐3 1‐8 25‐60
Horses with
babesiosis (n=7)
5,3 20,4
49,2
5,0 76,0 2,0 4,0 1,0 2,7 21,3
Table 2.
Derived blood constant in horses with babesiosis Blood
parameters VEM HEM CHEM
Measurement units
μ3 picograme (pg) g/dl
Reference 34‐58 13‐19 31‐37 Horses with babesiosis
(n=7) 47,0 16,6 35,2
Haematological examination revealed the existence of an anemic syndrome, normochromic normocytic regenerative anemia with a low number of red blood cells (5,3 mil/μl).
27
Universitatea de Științe Agricole și Medicină Veterinară Iași
We also observed a low number of leucocytes (5.0 thousand / ml). Increased hemoglobin (Hb = 20.4 g / dL) and hematocrit (Ht = 49.2%) showed the presence of dehydration. Biochemical profile results are presented in Table 3.
Table 3.
Biochemical profile in horses with babesiosis
Biochemical Profile
Hepatic profile Renal profile
TP AST ALT ALP GGT TBIL DBIL BUN CRTN
Measurement units
g/dl
UI/L UI/L UI/L UI/L mg/dl
mg/dl
mg/dl
mg/dl
Reference 5,7‐7,9
116‐
287
2,7‐21
70‐227
2,7‐22
0,3‐3,0
‐ 10,4‐25,0
0,9‐2,0
Horses with babesiosis
(n=7) 6,3 31,3
88,9
222,7
23,9
3,3 0,5 35,7 2,8
As seen in Table 3 there exists an hepatobiliary failure: ALT (alanine amino transferase)=88.9 IU/L, ALP (alkaline phosphatase)=222.7 IU/L, GGT (gamma‐glutamyl‐transferase)=23.9 IU/L, TBIL (total bilirubin)=3.3 mg/dL and renal failure: BUN (blood urea nitrogen)=35.7 mg/dL, CRTN (creatinine) = 2.8 mg/dL. Cytomorphological examination of the blood smear stained May Grunwald Giemsa revealed the existence of Babesia equi endoglobular merozoits and intense hemolysis (fig. 2).
Fig. 2.Babesia equi merozoits and hemolysis
Fig. 3.Splenomegaly and bleeding points in the heart base
28
Lucrări Științifice – vol 53 seria Medicină Veterinară
Macroscopic examination of internal organs from an animal died due to complications revealed splenomegaly and bleeding points in the heart base (Fig. 3). Cause of death was acute pulmonary edema and hemolytic anemia due to heavy parasitism (Fig. 4.)
Fig. 4.Acute pulmonary edema and tick parasitism
From the peripheral blood smear stained May Grunwald Giemsa were identified endoglobular parasites in all cases fact that confirmed the diagnosis. The treatment with Berenil in a dose of 0.0035 g/kg 7% extemporaneus prepared solution or Imizol in a dose of 4 ml/100 kg led to remission of clinical signs starting with the second day and clinical cure in 6 cases after about 3 days in which symptomatic treatment was also performed. CONCLUSIONS 1. Diagnosis of babesiosis has gone from a common hemosporidiosis clinical framework: cortical syndrome cortical in inhibition phase, subicter and dark urine. 2. Blood count revealed normochromic normocytic regenerative anemia, with a low number of red blood cells (5.3 x103/mm3). 3. Blood biochemical examination revealed hepato‐biliary insufficiency (ALT = 88.9 IU / L, ALP = 222.7 IU / L) and renal insufficiency (BUN = 35.7 mg / dl = 2.8 mg CRTN / dL). 4. Morphopatological were found bleeding points in the heart and splenomegaly. 5. The diagnosis of babesiosis was confirmed by eidentification of B. Equi endoglobular merozoits. BIBLIOGRAPHY 1. BOGHIAN V., SOLCAN GHE., LUMINIȚA DIANA HRIȚCU, BEŞCHEA‐CHIRIAC S. I., 2003, Particularități morfoclinice ale babesiozei canine, al IX‐lea Congres Național de Medicină Veterinară, Iaşi, Rev. Rom. Med. Vet., vol. 13, nr. 3‐4, p.288 şi Lucr. Şt. USAMV Iasi, Medicina Veterinara, vol. 46, p. 362‐364, ISSN 1454‐7406. 2. MORAILLON R., FOURRIER P., LEGEAY Y., LAPEIRE C., 1997, Dictionnaire pretique de therapeutique canine et feline, 4e ed, Masson, Paris. 3. DULCEANU N., CRISTINA TERINTE, MITREA L.I., CARMEN POLCOVNICU, 2000, Dicționar enciclopedic de parazitologie, Ed. Academiei Române, Bucureşti. 4. DULCEANU N., CRISTINA TERINTE, 1994, Parazitologie veterinară, vol. 1, Ed. Moldova, Iaşi. 5. THE MERCK VETERINARY MANUAL, 1998, eighth edition, Merck & Co., Inc. Whitehouse Station, NJ USA.
29
KERATOPATHIES IN CARNIVORES: CLINICAL SIGNS AND LOCAL
PATHOLOGIC RESPONSES
IOANA BURCOVEANU, I. BURTAN, ROXANA TOPALĂ, L.C. BURTAN, M. FÂNTÂNARIU
ioana.burcoveanu@gmail.com
The cornea is the perfectly transparent, avascular, anterior component of the fibrous, outer coat of the eye, along with the opaque, posterior sclera. Corneal pathology varies from congenital disorders to tumors, primary or by extension. Keratitis define the inflammation of the cornea, that may have numerous causes, like trauma, noninfectious (physical, chemical) or infectious (bacterial, viral, fungal, parasitic) agents, immune reactions. Acquired corneal pathology may be categorized as ulcerative or nonulcerative, infectious or noninfectious, or by cause, topography, depth, etc. Clinical signs can also vary greatly. Generally, we observe blepharospasm, photophobia, hyperemic conjunctiva, epiphora, serous or mucopurulent discharge that clings to the ocular surface. Because of its compact construction, pathologic reactions in the cornea tend to evolve differently, regarding their speed of onset and recovery. The majority of clinically important keratopathies develop one or more of the following local signs: edema, vascularisation, pigmentation, cellular infiltrates, accumulation of lipid or mineral material in the stroma and corneal fibrosis, with scar formation. Optimal aetiologic diagnosis and clinical management require knowledge of the clinical signs listed above.
Key words: cornea, keratopathies, symptoms, carnivores The cornea is the perfectly transparent, anterior component of the eye, playing the role of a convex ‐concave lens. It has no blood vessels or pigments, its thickness varying in animals from 0,56 to 1 mm (0.5 – 0.8 mm) (5), becoming less thicker at the perifery in dogs and cats (4). The posterior part of the outer, fibrous coat of the eye is the sclera. The point at which the cornea and sclera merge is called the limbus (1, 3, 4, 5). The cornea plays many roles, such as: mechanical, optical, immunological and tissue healing. (4) From outside to inside, the cornea has 5 layers: epithelium, its basement membrane (Bowman), stroma, Descemet’s membrane, endothelium (posterior epithelium). It is avascular and it has no pigments, but it has a sensitive innervation, provided by nasociliary nerves of the ophthalmic branch of the trigeminal nerve (cranial nerve V) (3, 5). The density of terminal nerves is higher in the center and lesser at the periphery of the cornea. The cornea is the first barrier of the globe, being exposed to exogenous disorders (trauma), endogenous factors (corneal dystrophies, which are inherited) or to the extension from other ocular tissues (anterior lens luxation, uveitis, neoplasia). The present paper resumes the symptoms of clinically important keratopathies: blepharospasm, epiphora, conjunctival hyperaemia, as well as the major pathologic responses: corneal edema, vascularisation, fibrosis (scar formation), melanosis, accumulation of an abnormal substance within the cornea (lipid, mineral), stromal malacia.
30
University of Agricultural Sciences and Veterinary Medicine, Iasi
Lucrări Științifice – vol 53 seria Medicină Veterinară
MATERIAL AND METHOD Research has been achieved on the number of cases presented for ophthalmic examination at the Faculty of Veterinary Medicine in Iasi, the Surgical Clinic, throughout the years 2007‐2010 and at the Alfort Veterinary University Hospital Centre (Centre Hospitalier Universitaire Vétérinaire Alfort – Ecole Nationale Vétérinaire Alfort (CHUVA‐ENVA), Maisons‐Alfort, France), in mars‐april 2010. From the total number of carnivores, we collected those presented for an ophthalmic disorder, especially that of the cornea. A relevant and thorough history, completed by an orderly and extended ocular examination, give a correct diagnosis and the possibility of successful clinical results. RESULTS AND DISCUSSIONS The general symptoms of keratopathies, that first draw the owner’s attention and after that of the veterinarian, are the ocular pain, translated by the blepharospasm, photofobia, epiphora, ocular discharge. Blepharospasm can be present at one eye or at both eyes, depending on the nature of the aetiological agent (virus, bacteria, immune complexes) (photos 1‐3). Discharge that accompany different corneal diseases can be serous or mucopurulent (photos 4‐6).
1. Bilateral blepharospasm 2. Right blepharospasm 3. Right blepharospasm
4. Unilateral epiphora 5. Mucopurulent discharge 6. Diffuse conjunctival hiperaemia, mucopurulent discharge The healthy cornea is completley transparent, due to the lack of blood vessels or pigments, but when pathologic disorders appear, we can observe some local pathologic changes that are important for the clinician. Clinically, the loss of corneal transparency is translated by corneal edema. Normally, corneal structures fight against water entry, especially the endothelium and the epithelium. The endothelium extracts water form the stroma, maintaining a relative dehydration. Any lesion of those two components of the cornea results in edema. Accumulation of water between the stromal colagen fibers gives the cornea a blue coloration, which becomes opaque. Corneal edema can be localized or diffuse, epithelial or endothelial, the latter being more intense and diffuse. (photos 7, 8).
CHUVA‐ENVA
CHUVA‐ENVA
31
Universitatea de Științe Agricole și Medicină Veterinară Iași
7. Diffuse corneal edema 8. Localized corneal edema When it appears, corneal vascularization is always pathological. Blood vessels can be superficial, deep or both. Superficial neovascularisation are „treelike” vesseles, originating in conjunctival circulation. They occur whenever there is a lesion in the epithelium or the anterior stroma. Deep vessels are short, parallel, „hedgelike”, originating in the cilliary circulation. The depth of new formed vessels is a good indicator of the depth of the initiating lesion. In cases of persistent or complicated lesions, a granulation tissue can occur. The dinamic of corneal neovascularisation is presented in photos 9‐14.
9.Superficial neovascularisation, cat. 10.Superficial vessels, cat. 11. Superficial vessels, dog.
12. Granulation tissue, dog. 13. Granulation tissue, cat 14.Deep vascularisation, dog. Corneal vascularisation is generally beneficial in stromal repair. Blood vessels advance from the limbus, until they invade the lesion, corneal healing and regain of transparency starting from the limbus, as it can be seen in photo 9. Keeping in mind those facts, although blood vessels can result in influx of pigments and inflammatory cells, easing corneal fibrosis, control if neovascularisation with the use of steroids is not always indicated. Corneal pigmentation is also called pigmentary keratitis. These terms ignore the possibility of other pigments, like hemoglobin or the soluble pigment in corneal sequestra in cats, than melanin to cause corneal opacity. Nevertheless, it must not be used as a diagnosis, for it is only a sign of chronic, persistent corneal irritation, that may have many causes, each with a different treatment. Melanin is deposited in the epithelium and the anterior stroma, migrating along with blood vessels, during the inflammatory process. Corneal melanosis is a sign of chronic irritation, as seen in cases of eye exposure due to facial nerve paralysis, lagophtalmos, frictional irritation (distichiasis, entropion) (photo. 15), tear film
CHUVA‐ENVA
CHUVA‐ENVA
CHUVA‐ENVA
CHUVA‐ENVA CHUVA‐ENVA
CHUVA‐ENVA
CHUVA‐ENVA 32
Lucrări Științifice – vol 53 seria Medicină Veterinară
abnormalities (keratocojunctivitis sicca) (photo 16), chronic immunologic stimulation (pannus) (photos 17, 18).
15.Ventral corneal pigmentation, dog. 16.Diffuse corneal pigmentation, dog.
17.Lateral corneal pigmentation, dog. 18. Ventral and lateral corneal melanosis, dog. Corneal fibrosis appears as a consequence of the stromal repair process, when collagen fibrils don’t order themselves in a parrallel manner, thus interfering with light transmission. The opacity is localised in the stroma, the epithelium being intact, with some new vessels being able to persist. Meanwhile, the scar can become clear, but will not disappear completely. The tendency to clear is greater in young animals and more often in cats. Scar melanosis and lipid accumulation often occurs in dogs. As it develops, the scar can be named nubecula, macula, albugo and leukoma. If iris fibers are attached to the corneal endothelium, the scar is named an adherent leukome, with an anterior synechia (photos 19‐23).
19.Macula, dog. 20, 21.Adherent leukoma, cat – profile, face.
22, 23.Adherent leukoma, cat, profile and face.
Lipid or mineral accumulations appear as sparkly, white deposits in the corneal stroma, situated underneath the epithelium. This type of lesion can be a primary disease in breeds like Beagle, Boxer, Airedale Terrier, Caniche, Cocker, Doberman (photos 24‐26).
CHUVA‐ENVA
CHUVA‐ENVA
CHUVA‐ENVA
CHUVA‐ENVA
CHUVA‐ENVA
33
Universitatea de Științe Agricole și Medicină Veterinară Iași
24.Corneal lipid dystrophy 25.Lipid‐calcium degeneration, 26.Lipid‐calcium in a Beagle. dog. degeneration, dog. Lipid dystrophy evolves bilaterally, it is not painful, with minimum implications on the animal’s sight and requires no treatment. Lipid degeneration is associated with signs of inflammation (keratitis, scleritis, uveitis), having the possibility to be the result of corneal ulcers or corneal traumatisms having scarred with lipid accumulation. In some animals, we may notice high levels of cholesterol in the blood, or other metabolic disorders, such as diabetes mellitus, hypothyroidism, hyperadrenocorticism or primaryhyperlipidemia. Stromal malacia or „melting” occurs when collagenase, the enzyme responsible of collagenolysis, is liberated by cells, especially neutrophils. The cornea becomes soft, due to its loss of rigidity (loss of collagen structure). The process is followed by developement of a deep corneal ulcer or descemetocele (photo 27).
27.Stromal melting, dog.
CONCLUSIONS 1. The cornea is the perfectly transparent, anterior component of the eye, playing the role of
a convex ‐concave lens, having no blood vessels or pigments. 2. The general symptoms of keratopathies, that first draw the owner’s attention and after
that of the veterinarian, are the ocular pain, translated by the blepharospasm, photofobia, epiphora, ocular discharge.
3. The majority of keratopathies develop one or more of the following local signs: corneal edema, vascularisation, pigmentation, cellular infiltrates, accumulation of lipid or mineral material in the stroma and corneal fibrosis, with scar formation.
4. Clinically, the loss of corneal transparency is translated by corneal edema, when water accumulates in the corneal stroma. Edema can be diffuse or localised.
5. Corneal vascularization is always pathological. Blood vessels can be superficial, deep or both. It has caracteristic aspects, indicating the depth of the initial lesion.
6. Corneal melanosis is not a diagnosis, but a sign of chronic irritation. Although it doesn’t require a treatment, we must determine the cause of irritation, to prevent further extension of pigmentation.
CHUVA‐ENVA CHUVA‐ENVA
34
Lucrări Științifice – vol 53 seria Medicină Veterinară
7. Lipid or calcium can accumulate in the superficial part of the stroma, without affecting the corneal epithelium.
8. Corneal fibrosis appears as a consequence of the stromal repair process, when collagen fibrils don’t order themselves in a parrallel manner, thus interfering with light transmission. Corneal scars are called: nubecula, macula, albugo and leukoma (simple or adherent, with iris participation).
REFFERENCES
1. Burtan I., 2000 – Chirurgie veterinară regională, ed. Ion Ionescu de la Brad, Iaşi; 2. Cernea P., Dumitrache L., 1986 – Fiziologie oculară, ed. Medicală, Bucureşti; 3. Cotea C., 2003 – Histologie specială, ed. Tehnopress, Iaşi; 4. Ionaşcu Iuliana, Miclăuş I., 2009 – Oftalmologie veterinară din Tratat de Medicină Veterinară, vol. V., coordonator Constantin N., ed. Tehnică, Bucureşti;
5. Maggs D.J., Miller P.E., Ofri R., 2008 – Slatter’s Fundamentals of Veterinary Ophthalmology, 4th edition, ed. Saunders Elsevier, Missouri;
35
PATHOLOGICAL EFFECTS AND TISSUE DISTRIBUTION OF MICROCYSTIN‐LR (MC‐LR) AFTER 48 HOURS NON INVASIVE
EXPOSITION OF NEWLY HATCHED MEDAKA (ORYZIAS LATIPES) ELEUTHERO‐EMBRYOS
Hélène Huet 1, Delphine Franko 2, Chakib Djediat 2, Eva Perez2, François Crespeau1 , Amaury de Luze2
1 Ecole Nationale Vétérinaire d’Alfort (France) 2 Muséum National d’Histoire Naturelle de Paris (France)
Abstract Medaka fishes eulethero‐embryos were submitted at 48 hours period of immersion in MC‐LR containing media at 1, 5, 10, 15 and 20 µg/ml concentration. Significant mortality (>10%) is only observed for higher MCLR concentration (20µg/ml) in medium. Microscopic pathological effects after 48 hours immersion in MC‐LR solution were searched on transverse sections of paraffin embedded embryos fixed in formaldehyde. Histopathologic studies of paraffin embedded embryos shows, from 10 µg/ml MC‐LR concentration, with variable intensity, vacuolization of enterocytes and hepatocytes, degenerative and necrotic changes. On same material, immuno‐labeling with specific monoclonal antibodies against MC‐LR was also performed and appeared constantly and strongly positive in intestine (enterocytes and lamina propria), liver (hepatocytes and probably macrophagic cells along sinusoids border). A faint labeling was also characterized in kidneys epithelial cells, pancreas and yolk vesicle epithelial border. No labeling was observed in skin, gills, oral epithelium, esophagus and stomach, heart and vascular system, muscles, nervous central system… Ultramicroscopic pathological effects after 48 hours immersion in MCLR solution were also searched on ultrathin sections of embryos fixed in paraformaldehyde and embedded in resin. From 10 µg/ml MC‐LR concentration, transmission electronic microscopy clearly shows disruption of intercellular junctions in enterocytes and hepatocytes, some cytoplasmic vacuolation of enterocytes, alteration of hepatocytes membrane with regression of microvillous cell border with reduction of Disse space length and abnormal biliary canaliculi border.
INTRODUCTION Microcystins (MCs) are a family of hepatotoxic cyclic heptapeptides comprising at least 80 variants and congeners. All toxic microcystin variants contain a unique hydrophobic amino acid 3‐amino‐9‐methoxy‐10‐phenyl‐2,6,8‐trimethyl‐deca‐4(E)‐dienoic acid (ADDA) (kongsuwan et al., 1988). The prototype compound is MC‐LR, which have Leucine (L) and arginine (R) at the two hypervariable positions in the ring structure (Rinehart et al., 1988; Carmichael, 1992). These toxins are produced by a wide variety of planktonic cyanobacteria, which are one of the most primitive and worldwide distributed families of photosynthetic organisms (Brock, 1973, Ueno et al., 1998). MCs represent potential environmental fresh water toxins, mainly when climatic conditions promote blooms of cyanobacteria in pools, pond or lakes. The primary toxic effect of microcystins is inhibitory reversible binding at the catalytic site of protein phosphatases 1 and 2A. This interaction involved principally the ADDA group. The presence of the methyl‐dehydro‐alanine (Mdha) inducted an irreversible inhibition by covalent linkage to the cystein sulphur on the phosphatases PP1 and PP2A (MacKintosh et al., 1995; Runnegar et al., 1995). Direct injection of MCLR in mammals induced protein phosphatases
36
Lucrări Științifice – vol 53 seria Medicină Veterinară
inhibition, hyperphosphorylation of membrane cellular proteins including the hepatocellular cytoskeleton and loss of cell‐cell contacts in intrahepatic necrosis and hemorrhage. Death is due to hypovolemic shock (Hooser et al., 2000, Beasley et al., 2000). After administration, MCs cellular uptake is performed via specific organic anion transport proteins (Runnegar et al., 1991, 1995). MCs exhibit a predominantly hepatic organotropism, althought mesenteric and even dermal effects have been demonstrated. In fish as in mammals, gavage, intraperitoneal, intravascular or intravitellin injection of purified MC‐LR are all invasive approaches corresponding to acute exposure and lethal toxic effects (Phillips et al., 1985, Raberg et al., 1991, Tencalla et al., 1994, Bury et al., 1997). However there are few indications of whether and how fish are sensitive to purified MC‐LR by in vivo immersion (Oberemm et al., 1999). Our studies were designed in view to develop a rapid sub‐lethal bioassay allowing not only a general assessment on uptake and tissue distribution of MC‐LR, but also indicating potential whole body external MC‐LR‐induced developmental abnormalities. Thus, our experimental studies was mainly realized in view to set up a low cost, sensitive and reproducible bioassay with some degree of the certainty on the absorption, distribution and effects of MC‐LR in fish after natural exposure. In these animals, the less invasive experimental approach to study MC‐LR effects is after natural immersion and the duration of our experimental procedure correspond to a short and acute exposure of two days. Medaka fish eleuthero‐embryos (Balon, 1975) could be contaminated by MC‐LR only via environmental water intake or by absorption of the purified toxin by skin or gills. Immersion also represents the most current way of exposure among human and animal populations having contact with cyanobacterial contaminated water (Funari and Testai, 2008). MATERIAL AND METHODS Products According to the recommendation of the manufacturer (Alexis, Switzerland), dissolution of purified MC‐LR in water is always incomplete; in absolute ethanol dissolution of MC‐LR is complete. A mixed procedure was used in our study: MC‐LR was first dissolved in four volume absolute ethanol, followed by addition of 1 volume of water. Ethanol was totally evaporated in a speedvac (37°C) during 4 hours and the mixture completed with water at the end of the procedure to a final concentration of 0.2 µg/ml (stock solution). A control solvent stock solution was performed using the same procedure. Medaka breeding and experimental procedure Medaka (Oryzias latipes) progenitors of the inbred cab strain were kept in 8‐L glass aquaria at 26‐28°C under artificial reproductive cycle (14h Light‐10h Dark cycle). Fertilized egg clusters were carefully removed from the female progenitors and 100‐200 post‐fertilized (pf) eggs of medaka fishes were collected and gathered in Petri dishes containing Yamamoto’s embryo rearing medium (Yamamoto, 1975). The embryos were maintained in an incubator (XBR125, France Etuve) at 25°C with a photoperiod (L:12h‐D:12h). The rearing medium was changed every day until the hatching period, beginning at the tenth day. Eleuthero‐embryo exposures and assessment All embryos hatching during the 24 hours interval of the tenth and eleventh day post fertilization were termed J0 embryo and used for experimental purpose in our acute eleuthero fish embryo test. During this interval of time and under our rearing condition, the percentage
37
Universitatea de Științe Agricole și Medicină Veterinară Iași
of hatched embryos represented approximately 60% (45 to 75%) of the collected eggs. The vesiculated eleuthero‐embryos were transferred in 12 wells microplates (5 eleuthero‐embryos in 2ml medium/well). Negative controls and MCLR media were not changed during the 48 hours experimental procedure. The vesiculated fish larvae being fully autotrophic, no food was given during the time course of the 48h experimental period. Non‐invasive observations of eleuthero‐embryos behavior were performed and eleuthero‐embryos were handled in accordance with European Union regulations concerning the protection of experimental animals. Histopathology process At the end of the immersion experiment, surviving hatched embryos treated or not (control) with MC‐LR were fixed in buffered formaldehyde solution 10% (v/v) for 24h. Fixed embryos were then clarified and dehydrated in successive baths of ethanol (70% and 95%) and butanol, and finally transferred into baths of liquid paraffin at 56°C. They were individually oriented and embedded into blocks of paraffin wax. Transverse sections (3,5µm thickness) were hydrated in successive baths of ethanol (100% and 95%) and routinely stained with Hematoxyline‐Eosine‐Saffron (HES, Sigma‐Aldrich, France). Microphotograph observations of histological transverse sections were carried out with an Axio‐Imager Z1 Zeiss microscope at various magnifications. The all embryo being cut, an constant anatomical level was chosen in the pectoral fin region to perform observations on intestine and liver. Immunohistochemistry process Sections of paraffin‐embedded tissues were deparaffined in toluene and hydrated gradually in ethanol (100% and 95%), washed in distilled water and then in 10mM phosphate buffered saline (PBS, Sigma‐Aldrich, France). Tissue sections were microwaved in 10mM citrate buffer, pH 6.0 for 30min (350w microwave oven). Two different primary anti‐MCLR monoclonal antibodies (Alexis Biochemicals, Switzerland) were tested: AD4G2 which recognizes all microcystins because of its Adda specification and MC10E7 which recognizes all 4‐Arg microcystins. The immunoassay was routinely performed with the NexES system (Ventana, Tucson, USA). As positive control, we choose an adult medaka fish liver, which proceeded from a gavage experiment with MCLR (Mezhoud and al, 2008), and tissue sections proceeded without primary antibody were chosen as negative control. Transmission electron microscopy Embryos were preserved in 0.5% glutaraldehyde in 2% paraformaldehyde solution for transmission electron microscopy study during 24 hours and then, washed three times in Sorensen phosphate buffer (0.1M, pH 7.4) in three successive 10min baths; finally embryos were dehydrated in ethanol (50°, 70°, 90° and 100°) by three baths at each step of dehydration and the embedded in a epoxy mixture (Spur). Medium and ultrathin sections were sliced with diamond knives (Diatome) on a Reichert‐Jung Ultracut microtome. Ultrathin sections on grid were then observed by transmission electronic microscope (Hitachi H 700S) with a camera (LCD, Hamamatsu) at various magnifications.
38
Lucrări Științifice – vol 53 seria Medicină Veterinară
RESULTS 1) Pathological effects of MCLR in eleuthero‐embryos medaka after 48 hours toxic exposure by immersion The intestine wall of control eleuthero‐embryo medaka fish is organized in folds lined by simple columnar epithelium composed of enterocytes and not associated with any kind of mucosal or submucosal glands; MC‐LR treatment appears to induce a slight reduction of the intestinal folds associated with a moderate enlargement of the intestinal lumen and variable degree of vacuolization of enterocytes with, sometimes, focal cleavage between epithelium and lamina propria. In liver, the normally dense network of hepatocytes and vascular sinuses is observed in control. In treated embryos, degenerative more or less megalocytic hepatocytes with sometimes anisocytosis, anisocaryosis and nucleus pycnosis are clearly observed; furthermore some necrotic hepatocytes are also apparent in 20µg MC‐LR/ml treated embryos. In some embryos, vacuolization of kidney epithelial is sometimes observed. Another happening modification concerns yolk vesicle seeming to have late regression without clear lesions of syncytial epithelial cells at photonic microscopic observation level. No significant lesions are observed in other tissues or organs: skin, gills, oral and esophagus mucous membrane, nervous system tissue, muscle, spleen, cardiovascular system, pancreas, esophagus… 1) Immuno‐localization of MCLR Using MCLR specific antibodies as described supra, a strong labeling is observed at 48 hours in eleuthero‐embryos treated by MCLR in intestinal mucous membrane (enterocytes and lamina propria) and liver (hepatocytes and probably sinusoidal border associated macrophages). Labeling is more intense in 20µg than in 10µg MCLR/ml treated embryos. No labeling is observed in other organic structures (nervous tissue, other mucous membranes, spleen, muscle, skin and gills, cardiovascular organs….) but in yolk vesicle epithelial membrane where very light labeling is sometimes observed. 2) Ultra structural observation Ultrastructural analysis performed on surviving eleuthero‐embryos indicated in enterocytes and hepatocytes of treated animals, a complex set of changes on cytoskeletal structures with no clear changes of nuclear chromatin, Golgi apparatus or mitochondria. In the liver, endothelial cells appeared normal but a reduction of length of Disse's space was noticed in treated fishes, due to reduction of the microvillus border of hepatocyte vascular faces. A reduction of microvillus hepatocyte border was also noticed at the biliary surface of these cells (in biliary canaliculi). Disjunction between hepatocytes was also observed and some vacuolization of the cytoplasm. In enterocytes, a clear dissociation of the apical junction complex was noticed, associated to vacuolization of the cytoplasm.
39
Universitatea de Științe Agricole și Medicină Veterinară Iași
DISCUSSION Immersion in elevated MC‐LR concentrations had apparently no significant external effect in fish and amphibian, in contrast to the lethal observations performed after intra‐peritoneal injection and oral application (gavage) of MC‐LR (Phillips et al., 1995, Tencella et al., 1994, Oberemm, 1999). However, in fish eleuthero‐embryos species transferred in toxin‐free media after embryonic development and hatching pre‐exposure to MCs, usually malformations, embryonic growth inhibition and hepatocellular toxicity occurred (Zhang et al., 2008, El Ghazali et al., 2009) with apparently weak desire for food (Zhang et bal., 2008). Medaka fish at the eleuthero‐embryo stage are fully autotroph during the first four days after hatching. In our experience, these vesiculated larvae expressed no significant external and histopathological effects when exposed by immersion during 48 hours in medium containing 1 to 10 µg MC‐LR/ml. Significant mortality (>10%) during the experimental period (48 hours) was only observed when vesiculated embryos were immersed at the highest concentration of MC‐LR (20µg/ml). Our observation agrees Oberemm et al. data (1999) who did not observed any effect of MCLR at concentration as high than 0.1, 1 and 5 µg/ml in zebrafish eleuthero‐embryos (Danio rerio) after 48 hours exposure. However, the same embryos showed, at the dose of 10µg MCLR/ml, pectoral edema and enlarged and opaque yolk after 24 hours exposure. Similarly, no effect on morphological development or survival during 10 days exposure were noticed during larval development (tailbud stage) in the toad (Bufo arenarum) at concentrations of 1‐20mg MC‐LR /l (Chernoff et al., 2002). Nevertheless, one study showed during embryonic and larval stages of loach (Misgursuns mizolepis) a very high sensitivity to MC‐LR exposure, resulting in pericardial edema and tubular heart, bradycardia, poor yolk absorption, small head, curved body and tail, and abnormal hatching. Heart and liver were found to be primary targets of MC‐LR in this later study (Liu et al., 2002). Therefore, the loach (Misguruns mizolepsis) appears the most sensitive fish species tested. In our medaka eleuthero‐embryos toxic test, using available commercially monoclonal antibodies, we could clearly immunolocalize MC‐LR, mainly in intestine and liver whereas some faint localization of MC‐LR was also detected in pancreas, kidney and yolk vesicle. At histological examination (paraffin embedded tissue with trichromic stain), lesions of enterocytes and hepatocytes were clearly detected; mainly vacuolization but also variation of size cells with anisocytosis and anisocaryosis and necrotic changes with pycnosis in hepatocytes. At ultrastructural level, one of the main observed effects of MC‐LR was the rupture of the junction systems on the latero‐apical side of the enterocytes and between hepatocytes; these observations are in good agreement with Wang’s publication (Wang et al., 2005) describing loss of blastomere coherence by interfering the distributions of β‐catenin and cadherines in zebrafish embryo after MC‐LR microinjection. During our 48 hours toxic assay, immunolocalization of MC‐LR could be obtained mainly in intestine and liver, likely indicating uptake and binding of MC‐LR by enterocytes and transfer and bioaccumulation into the liver (hepatocytes and probably local macrophages). MCLR was also labeled with lighter intensity in pancreas and kidneys epithelial cells. In contrast, oral, esophagus and stomach mucosa did not show any sign of MC‐LR fixation or accumulation. No other labeling was observed in skin, gills, heart and vascular system, central nervous tissue or muscle. Furthermore, no rupture of intercellular junction complex or other significant lesions were observed in these organs and tissues.
40
Lucrări Științifice – vol 53 seria Medicină Veterinară
Nevertheless, we are interested in tracing MC‐LR in epithelial syncytia cells of yolk vesicle (data not shown) and some further studies are required during the early time of immersion to precise the toxico‐dynamic of MCLR uptake. Normal liver tissue in fish is organized in a tubulo‐sinusoidal pattern and differs from the lobular pattern characteristic of mammalian liver. Medaka liver consists of sheet‐like arrangements of parenchymal cells with interlacing sinusoids and few bile ducts and caniculi (Hinton and Couch, 1998; Boorman et al., 1997). The fenestrated endothelium of sinusoids acts as a sieve, preventing passage of blood cells in the Disse’s space, but allowing some blood proteins and small lipoproteins to pass through. Indeed, microvilli of hepatocyte membrane increase the exchange surface of these cells along the Disse’s space border and also along the bile canaliculi border. Ultrathin sections observations using microscopy approach indicated that medaka fish embryos exposed to 10 or 20µg MC‐LR/ml showed a clear reduction of membrane hepatocyte microvilli on the Disse’s space and on the biliary canaliculi surfaces. These clear ultrastructure changes certainly results in a reduced exchange efficiency in hepatocyte of MC‐LR‐treated medaka eleuthero‐embryos. Microcystin is known to cause liver damages in fish (Philipps et al., 1985, Rabergh et al., 1991, Tencalla and Dietrich, 1997) and to affect the bile acid transport system involved in MC‐LR transport in hepatocyte (Runnegar et al., 1995). Controversial data are found depending of the species in the literature concerning the bioaccumulation of MC in the liver following gill membrane absorption of MC (Casenave et al., 2005, Xie et al., 2005) whereas others studies suggest that epithelia of gills and skin of freshwater fish form a barrier to MC transport (Tencalla et al., 1994, Bury et al., 1995). In contrast to others studies (Gaete et al., 1994, Bury et al., 1995, Zambrano and Canelo, 1996) no gills damaging was observed in our study whatever was MC‐LR concentrations of the medium. Finally, histopathological and immuno‐histopathological studies permit to have better comprehension of MCs toxicity and better knowledge about ways of penetration, tissue repartition and pathological effect of this important class of natural environmental toxins. Bibliography
1. Azevedo SM, Carmichael WW, Jochimsen EM, Rinehart KL, Lau S, Shaw GR, Eaglesham GK (2002). Human intoxication by microcystins during renal dialysis treatment in Caruaru‐Brazil. Toxicology. 181‐182:441‐6.
2. Balon, E. K. J Fish Res Board Canad 1975, 32, 1663 1670 3. Beasley VR, Lovell RA, Holmes KR, Walcott HE, Schaeffer DJ, Hoffmann WE, Carmichael WW.
2000. MCLR decreases hepatic and renal perfusion, and causes circulatory shock, severe hypoglycemia, and terminal hyperkalemia in intravascularly dosed swine. J Toxicol Environ Health A. 61(4):281‐303
4. Brock TD. 1973. Lower pH limit for the existence of blue‐green algae: evolutionary and 5. ecological implications. Science. 179(72):480‐3. 6. Bury, N. R.; McGeer, J. C.; Eddy, F. B.; Codd, G. A. J Fish Diseases 1997, 20, 209 215. 7. Carbis, CR, Rawlin, GT, Grant, P, Mitchell, GF, Anderson, JW, McCauley, I (1997) A study of feral
carp, Cyprinus carpio L., exposed to Microcystis aeruginosaat Lake Mokoan, Australia, and possible implications for fish health. JFish Dis 20: 81‐91
8. Carmichael WW. 1992. Cyanobacteria secondary metabolites—the cyanotoxins. J Appl Bacteriol. 72: 445–59
9. Carmichael WW, Azevedo SM, An JS, Molica RJ, Jochimsen EM, Lau S, Rinehart KL, Shaw GR, Eaglesham GK. 2001. Human fatalities from cyanobacteria: Chemical and biological evidence for cyanotoxins. Environ Health Perspect. 109:663‐68
41
Universitatea de Științe Agricole și Medicină Veterinară Iași
10. Chernoff N, Hunter ES 3rd, Hall LL, Rosen MB, Brownie CF, Malarkey D, Marr M, 11. Herkovits J. 2002. Lack of teratogenicity of microcystin‐LR in the mouse and 12. toad. J Appl Toxicol. 22(1):13‐7 13. Donnan GA, Fisher M, Macleod M, Davis SM (2008). "Stroke". Lancet 371 (9624): 1612–23. 14. Funari E, Testai E. (2008) Human health risk assessment related to cyanotoxins exposure. Crit
Rev Toxicol.. :38(2):97‐125 15. Hindman SH, Favero MS, Carson LA, Petersen NJ, Schonberger LB, Solano JT. 1975. Pyrogenic
reactions during haemodialysis caused by extramural endotoxin. Lancet. 2: 732–34 16. Hooser SB. 2000. Fulminant hepatocyte apoptosis in vivo following microcystin‐LR
administration to rats. Toxicol Pathol. 28(5):726‐33 17. Kungsuwan A, Noguchi T, Matsunaga S, Watanabe MF, Watabe S, Hashimoto K. (1988)
Properties of two toxins isolated from the blue‐green alga Microcystis aeruginosa. Toxicon. 26(2):119‐25.
18. Liu Y, Song L, Li X, Liu T. 2002. The toxic effects of microcystin‐LR on embryo‐larval and juvenile development of loach, Misguruns mizolepis Gunthe. Toxicon. 40(4):395‐9
19. Magalhães VF, Soares RM, Azevedo SM. (2001)‐ Microcystin contamination in fish from the Jacarepaguá Lagoon (Rio de Janeiro, Brazil): ecological implication and human health risk. Toxicon, 39(7):1077‐85
20. MacKintosh RW, Dalby KN, Campbell DG, Cohen PT, Cohen P, MacKintosh C. 1995. The cyanobacterial toxin microcystin binds covalently to cysteine‐273 on protein phosphatase 1. FEBS Lett. 371(3):236‐40.
21. Mezhoud K, Bauchet AL, Château‐Joubert S, Praseuth D, Marie A, François JC, Fontaine JJ, Jaeg JP, Cravedi JP, Puiseux‐Dao S, Edery M. (2008)‐ Proteomic and phosphoproteomic analysis of cellular responses in medaka fish (Oryzias latipes) following oral gavage with microcystin‐LR . Toxicon.;51(8):1431‐9
22. Mezhoud K, Praseuth D, Puiseux‐Dao S, François JC, Bernard C, Edery M. (2008)‐ Global quantitative analysis of protein expression and phosphorylation status in the liver of the medaka fish (Oryzias latipes) exposed to microcystin‐LR I. Balneation study. Aquat Toxicol.; 86(2):166‐75.
23. Mezhoud K, Praseuth D, Francois JC, Bernard C, Edery M. (2008)Global quantitative analysis of protein phosphorylation status in fish exposed to microcystin. Adv Exp Med Biol; 617:419‐26
24. Phillips, M. J.; Roberts, R. J.; Stewart, J. A.; Codd, G. A. J. Fish Diseases 1985, 8, 339 344. 25. Rabergh, C. M. I.; Bylund, G.; Eriksson, J. E. Aquat Toxicol ̊ 1991, 20, 131‐146 26. Rinehart KL, Harada K‐I, Namikoshi M, Chen G, Harvis C, Munro MHG, Blunt JW, Mulligan
PE,Beasley VR, Dahlem AM, Carmichael WW. 1988. Nodularin, microcystin and the configuration of ADDA. J Am Chem Soc 110:8557‐58
27. Runnegar M, Berndt N, Kong SM, Lee EY, Zhang L. (1995a). In vivo and in vitro binding of microcystin to protein phosphatases 1 and 2A. Biochem Biophys Res Commun. 216(1):162‐9
28. M.T. Runnegar, R.G. Gerdes and I.R. Falconer, The uptake of the cyanobacterial hepatotoxin microcystin by isolated rat hepatocytes, Toxicon 29 (1991), pp. 43–51.
29. M. Runnegar, N. Berndt and N. Kaplowitz, (1995b) Microcystin uptake and inhibition of protein phosphatases: effects of chemoprotectants and self‐inhibition in relation to known hepatic transporters, Toxicology and Applied Pharmacology 134 (1995), pp. 264–272
30. Soares RM, Yuan M, Servaites JC, Delgado A, Magalhães VF, Hilborn ED, Carmichael WW, Azevedo SM (2006). Sublethal exposure from microcystins to renal insufficiency patients in Rio de Janeiro, Brazil. Environ Toxicol. 21(2):95‐103
31. Tencalla, F. G., Dietrich, D. R. and Schlatter, C. (1994) Toxicity of Microc~stis aeruginosa peptide toxin to rainbow trout (Oncorhynchus mykiss). Aquatic toxic. 30, 215‐224.
32. Tencalla, F. and Dietrich, D., 1997. Biochemical characterization of microcystin toxicity in rainbow trout (Oncorhynchus mykiss). Toxicon 35, pp. 583–595.
33. Ueno Y, Nagata S, Suttajit M, Mebs D and Visconcelos V.1998. Immunochemical survey 34. of microcystins in environmental water in various countries. Eds.M Miragala, H van Egmond, C
Brera and J Gilbert. In. Mycotoxins and Phycotoxinsdevelopments in chemistry, toxicology and
42
Lucrări Științifice – vol 53 seria Medicină Veterinară
food safety. Alaken Inc. Fort Collins, Colorado. 35. Watanabe MF, Oishi S. 1985 Effects of environmental factors on toxicity of a 36. cyanobacterium (Microcystis aeruginosa) under culture conditions. App Environ 37. Microbiol. 49: 1342‐44 38. Wiegand, C., Pflugmacher, S., Oberemm, A., Meems, N., Beattie, K.A., Steinberg, C.E.W. and
Codd, G.A., 1999. Uptake and effects of microcystin‐LR on detoxication enzymes of early life stages of zebrafish (Danio rerio). Environ.
43
PREVALENCE OF CRYPTOSPORIDIUM SPP. AND OTHER
ENTEROPATHOGENS INFECTIONS AT CALVES IN WESTERN, CENTRAL AND NORTH‐WESTERN ROMANIA
Gh. DĂRĂBUŞ1, V. COZMA2, K. IMRE1, A. BEJAN2, M.S.ILIE1, MIRELA IMRE1
1 – Faculty of Veterinary Medicine Timişoara, Calea Aradului, nr. 119 2 ‐ Faculty of Veterinary Medicine Cluj‐Napoca, Calea Mănăştur, nr. 3‐5
e‐mail: gheorghe.darabus@fmvt.ro
Summary: The aim of the research was to reveal the most important enteropathogen agents in calves in the first months of life and to establish their prevalence in Western, Central and North‐Western Romania. The study was carried out on 370 calves, with or without diarrhea, in seven Counties. Based on the copro‐ELISA test, infections with Cryptosporidium (41.4%), rotavirus (16.2%), coronavirus (10.3%) and Escherichia coli F5 (K99) enteropathogen (1.08%), were identified. The most common association was semnalated between Cryptosporidium spp. and coronavirus (5.9%) followed by Cryptosporidium spp. ‐ rotavirus (5.4%) mixed infection. Higher prevalence observed in monoinfections (38.4%) compared with associated infections (14.3%), may suggest a possible competition for the same biotope.
Key words: Cryptosporidium spp; rotavirus; coronavirus; Escherichia coli F5. Discovered in 1907 by Tyzzer in the gastric glands of mice, protozoans to the genus Cryptosporidium are present in many domestic animals, humans and other vertebrates, having large host specificity. In the last decades, given the pathological and zoonotic implications, interest in studying this parasite has increased enormously, many knowledge being accumulated on biology, epidemiology, diagnosis and control of this parasitosis (3, 4, 10, 11, 12, 17, 18, 19, 31). In mammals, especially in calves, in uncomplicated infections with microbial agents, cryptosporidiosis causes an increased morbidity but generally, low mortality. Calves, especially during the first month of life, are most frequently affected by Cryptosporidium, which is one of the major enteropathogens involved in neonatal diarrhea. Infection with Cryptosporidium spp. is often associated with coronavirus, rotavirus and Escherichia coli F5 (K99) (1, 8, 9, 13, 14, 27, 30). As the diarrheal disease syndrome in calves is very important, conventional diagnosis methods were improved with immunological methods, for detection of oocysts and other enteropathogens in faeces (22, 28). The sensitivity and specificity of immunological methods is undoubtedly (21, 22, 26). The aim of this study was to determine the prevalence of cryptosporidiosis and other infections with three enteropathogen agents, in calves, in the first month of life, using ELISA test in Western, Central and North ‐ Western Romania. MATERIALS AND METHODS The study was carried out in Western, Central and North‐Western Romania in seven Counties (Arad, Bihor, Caraş‐Severin, Timiş, Cluj, Mureş and Satu Mare). A number of 370 calves, aged
44
Lucrări Științifice – vol 53 seria Medicină Veterinară
between 1‐30 days, with or without diarrhea, were examined between January 2008 and December 2009. Faecal samples were collected directly from the rectum in sterile plastic bottles. Recipients were stored at 4°C and the samples were processed using a coproantigen‐ELISA test within 24 hours. The ELISA kit used were: BioX Easy‐Digest (BIO K 151) and BioX Duo Digestive ELISA Kit (BIO K 083) according to the manufacturer’s instructions.
RESULTS AND DISCUSSIONS The prevalence of infection with Cryptosporidium and other enteropathogens in calves, in the first month of life, in investigated areas from Romania, are summarized in table 1.
Table 1 Infections with enteropathogens in calves, in the first months of life, in Western, Central and
North‐Western Romania
Infection with
Investigated areas
Total (n=370)
Western Romania (n=315)
Central and North‐Western Romania
(n=55)
number of positive samples (%) Cryptosporidium spp. 140 (44.4) 13 (23.6) 153 (41.4)Rotavirus 52 (16.5) 8 (14.5) 60 (16.2)Coronavirus 33 (10.5) 5 (10) 38 (10.3)
E. coli F5 (K99) 4 (1.3) 0 4 (1.08)
Negative 86 (27,3) 29 (52.7) 115 (31.08)
Legend: n = number of animals investigated. On the whole, the prevalence of Cryptosporidium spp. infections was 41.4%. The investigations carried out in Western Romania revealed a significant higher prevalence (p<0,05) for Cryptosporidium infection compared with Central and North‐Western Romania. Rotavirus infections were located in the second place, as weight (16.2%). Infections with coronavirus had a prevalence of 10.3% and E. coli F5 (K99) was found in 1.08 percent. On the whole, in the investigated areas, 31.08% from the processed samples were negative for the enteropathogens tested. In the table 2 the prevalence of Cryptosporidium spp. and other enteropathogens, unique or associated/concurrent infections is presented. Overall, infections diagnosed (with Cryptosporidium, rotavirus, coronavirus and E. coli F5 (K99) had a prevalence of 52.7%. Monoinfections ordered by prevalence were Cryptosporidium (27.8%), rotavirus (8.4%), coronavirus (1.9%) and E. coli F5 (K99) (0.3%). Cryptosporidium was found in associated infections in a proportion relatively close, with rotavirus and coronavirus although prevalence was higher as a single pathogen. The aim of the research was to find the most important intestinal pathogens from calves aged between one day and 30 days, and to determine their prevalence. It was concluded that, in Western, Central and North‐Western Romania, the calves aged up to one month, the most important pathogen is Cryptosporidium followed by rotavirus, coronavirus and E. coli F5 (K99). The prevalence of infection with Cryptosporidium (41.4%)
45
Universitatea de Științe Agricole și Medicină Veterinară Iași
found in calves in this study is close to that obtained from De la Fuente et al. (1998b) in Central Spain (52.3%) which also made epidemiological investigations in young cattle in the first month of life. Similarly, in Germany, Otto et al. (1995), found in calves, in the first three weeks of life, a prevalence of Cryptosporidium infection of 52.5%.
Table 2 Prevalence of infection with enteropathogens in calves in the first months of life in
investigated areas of Romania Infection(s) with Positive samples (%) (n=370)
Cryptosporidium alone 103 (27.8) Rotavirus alone 31 (8.4) Coronavirus alone 7 (1.9) E. coli F5 (K99) alone 1 (0.3) Cryptosporidium + Coronavirus 22 (5.9) Cryptosporidium + Rotavirus 20 (5.4) Cryptosporidium +E. coli F5 (K99 2 (0.5) Coronavirus + Rotavirus 3 (0.8) Cryptosporidium + Rotavirus + Coronavirus 5 (1.3) Cryptosporidium + Rotavirus + Coronavirus+E. coli F5 (K99)
1 (0.3)
Total 195 (52.7) Legend: n = number of animals investigated The second enteropathogen agent, as prevalence (16.2%), was rotavirus. It is however less prevalent than reported by other authors in Israel (41.4%), Spain (42.7%), Ireland (38.9%) (6, 15, 16). Values close to those reported by us were reported by Abraham et al. (1992) in Ethiopia (16.7%), Garcia et al. (2000) in Spain (20.4%) and Pérez et al (1997) in Costa Rica (7%). Coronavirus infection prevalence in calves (10.3%) found in the investigated areas are comparable to that found by Akam et al. (2004) in Algeria (7.5%). Lower prevalence of E. coli F5 (K99) infection found in our study may be a consequence of reduced sensitivity of tetravalent ELISA‐kit, fact reported in a paper by de Fuente et al. (1998a). Mixed infections were found in 14.3% of the investigated calves. The most common association observed was between Cryptosporidium and coronaviruses (5.9%) followed by Cryptosporidium – coronavirus association (5.4%). This fact is in contradiction with the results published in the majority of studies worldwide, who sustained that the most common mixed infection is with Cryptosporidium and rotaviruses (6, 13, 16, 20). The four pathogen agents identified by ELISA, evoluated as unique infections and lass as associated infections. This may suggest a competition between different enteropathogen agents for the same biotope.
CONCLUSIONS
The epidemiological screening carried out using ELISA double‐sandwich technique at
young calves, in the first month of life, from Western, Central and North‐Western Romania revealed a prevalence of 41.4% for cryptosporidiosis, 10.3 for coronavirosis, 16.2% for rotavirosis and 1.08% for enterotoxigen E. coli F5 infection.
46
Lucrări Științifice – vol 53 seria Medicină Veterinară
The most common association was semnalated between Cryptosporidium spp. and
coronavirus (5.9%) followed by Cryptosporidium spp. ‐ rotavirus (5.4%) mixed infection. Higher prevalence observed in monoinfections (38.4%) compared with associated
infections (14.3%), may suggest a possible competition for the same biotope.
ACKNOWLEDGEMENTS
The current research was based on grant (51‐034/2007 PN II ‐ Parteneriate) obtained by Prof. Dărăbus from CNMP.
REFERENCES
1. ABRAHAM, G., ROEDER, P.L., ROMAN, ZEWDU, 1992. Agents associated with neonatal
diarrhoea in Ethiopian dairy calves. J. Trop. Animal Health and Production., 24: 1573‐1589. 2. AKAM A., KHELEF, D., KAIDI R., LAFRI, M., RAHAL, KH., CHIRILA, F., COZMA V., 2004.
Frequency of Cryptosporidium parvum, Escherichia coli K99 and Salmonella spp. isolated from calves in six breeding farms from Mitidja, Algeria, Bull. USAMV Cluj Napoca, Seria. Med Vet. 61: 287‐290.
3. AKIYOSHI, D.E., FENG, X., BUCKHOLT, M.A., WIDMER, G., TZIPORI, S., 2002. Genetic analysis of a Cryptosporidium parvum human genotype 1 isolate passaged through different host species. Infect. Immun., 70: 5670‐5675.
4. AL‐BRIKAN, F.A., SALEM, H.S., BEECHING, N., HILAL, N., 2008. Multilocus genetic analysis of Cryptosporidium isolates from Saudi Arabia. J. of Egyptian Society of Parasitol., 38: 645‐658.
5. ANGUS, K.W., 1987. Cryptosporidiosis in domestic animals and humans. In Practice, March., 47‐49
6. BRENNER, J., ELAD, D., MARKOVICS, A., GRINBERG, A., TRAININ, Z., 1993. Epidemiological study of neonatal calf diarrhoea in Israel‐a one‐year survey of faecal samples. Isr. J. Vet. Med., 48: 113‐116.
7. CHERMETTE, R., BOUFASSA, S., 1988. Cryptosporidiose: une maladie animale et humaine cosmopolite, O.I.E., Série Technique, Nr. 5
8. CHINSANGARAM, J., SCHORE, C.E., GUTERBOCK, W., 1995. Prevalence of group A and group B rotaviruses in the feces of neonatal dairy calves from California. Com. Immunol. Microbiol. Infect. Dis., 18: 93–103.
9. CLARK, M.A., 1993. Bovine coronavirus. Br. Vet. J., 149: 51–70. 10. CURRENT, W.L., 1988. The biology of Cryptosporidium. A. S. M. News., 54: 605‐611. 11. DĂRĂBUŞ, GH., 1996. Criptosporidioza: cercetări privind etiologia, epidemiologia, patogenia,
diagnosticul şi tratamentul în infecțiile naturale şi experimentale. Teză de doctorat, Facultatea de Medicină Veterinară ‐Timişoara.
12. DĂRĂBUŞ, GH., 1997. Criptosporidioza la om şi animale. Ed. Brumar, Timişoara. 13. DE GRAAF, C.D., VANOPDENBOSCH, E., ORTEGA‐MORA, L.M., ABBASSI, H., PEETERS, J.E.,
1999. A review of the importance of cryptosporidiosis in farm animals. Int. J. Parasitol., 29: 1269‐1287.
14. DE LA FUENTE, R., GARCIA, A., RUIZ‐SANTA‐QUITERIA, J.A., LUZON, M., CID, D., GARCIA, S., ORDEN, J.A., GOMEZ‐BAUTISTA, M., 1998. Proportional morbidity rates of enteropathogens among diarrheic dairy calves in central Spain. Prev. Vet. Med., 36: 145‐152.
15. DE LA FUENTE, R., LUZON, M., RUIZ‐SANTA‐QUITERIA, J.A. GARCIA, A., CID, D., ORDEN, J.A., GARCIA, S., SANZ, R., GOMEZ‐BAUTISTA, M., 1998. Cryptosporidium and concurrent infections with other major enteropathogens in 1 to 30‐Zile‐old diarrheic dairy calves in central Spain. Vet. Parasitol., 80: 179‐185.
16. FAGAN, J.G., DWYER, P.J., QUINLAN, J.G., 1995. Factors that may affect the occurence of enteropathogens in the faeces of diarrhoeic calves in Ireland. Irish Vet. J., 48: 17‐21.
47
Universitatea de Științe Agricole și Medicină Veterinară Iași
17. FAYER, R., 2008. The general biology of Cryptosporidium, p. 1‐41. In R. Fayer, L. Xiao, (ed),
Cryptosporidium and cryptosporidiosis. CRC Press, Inc., Boca Raton, Fla. 18. FAYER, R., MORGAN, U., UPTON, S. J., 2000. Epidemiology of Cryptosporidium: transmission,
detection and identification. Int. J. Parasitology., 30: 1305‐1322. 19. FAYER, R., UNGAR, B.L.P., 1986. Cryptosporidium spp. and Cryptosporidiosis. Microbiol. Rev.,
50: 458‐483. 20. GARCIA, A., RUIZ‐SANTA‐QUITERIA, J.A., ORDEN, J.A., CID, D., SANZ, R., GOMEZ‐BAUTISTA,
M., FUENTE, R., 2000. Rotavirus and concurrent infections with other enteropathogens in neonatal diarrheic dairy calves in Spain. Comp. Immun. Microbiology & inf. Diseases., 23: 175‐183.
21. GRACZYK, T.K., CRANFIELD, M.R., FAYER, R., 1996. Evaluation of commercial enzyme immunoassay (EIA) and immunofluorescent antibody (IFA) test kits for detection of Cryptosporidium oocysts of species other than Cryptosporidium parvum. Am. J. Trop. Med. Hyg., 54: 274‐279.
22. IMRE, K., DĂRĂBUŞ, GH., ILIE, M.S., MIRELA PALCA, TAMASY L., 2008. Evaluation of some diagnosis methods in cryptosporidiosis. Scientific Works ‐ Veterinary Medicine C Series., 53: 269‐276.
23. IMRE, K., MATOS OLGA, DĂRĂBUŞ, GH., NARCISA MEDERLE, OPRESCU, I., MORARIU, S., ILIE, M., IONELA HOTEA, MIRELA IMRE, 2009. First genetic identification of Cryptosporidium spp. in cattle in Romania. Lucrări Ştiințifice Medicină Veterinară, 52:26‐30.
24. OTTO, V.P., ELSCHNER, M., GÜNTHNER, H., SCHULZE, F., 1995. Vergleichende Untersuchungen yum nachweis von Rotaviren, Coronaviren, Kryptosporidien und enterotoxigen E. coli im Kot durchfallkranker Kälber. Tierärztl Umschau., 50: 80‐86.
25. PÉREZ, E., KUMMELING, A., JANSSEN, M.M.H., JIMÉNEZ, C., ALVARADO, R., CABALLERO, M., DONADO, P., DWINGER, R.H., 1997. Infectious agents associated with diarrhoea of calves in the canton of Tilárán, Costa Rica. Prev. Vet. Med., 33: 195‐205.
26. RODAK, L., BABIUK, L.A., ACRES, S.D., 1982. Detection by radioimmunoassay and enzymelinked immunosorbent assay of coronavirus antibodies in bovine serum andlacteal secretions. J Clin Microbiol., 16: 34–40.
27. SCHLAFER, D.H., SCOTT, F.W., 1979. Prevalence of neutralizing antibody to the calf rotavirus in New York cattle. Cornell. Vet., 69: 262–71.
28. SMITH, H.V., 2007. Diagnostics p. 173‐203. In Fayer, R., Xiao, L. (ed.), Cryptosporidium and cryptosporidiosis. Second Edition. CRC Press and IWA Publishing., Boca Raton, Fla.
29. SNODGRASS, D.R., TERZOLO, H.R., SHERWOOD, D., CAMPBELL, I., MENZIES, J.D., SYNGE B.A., 1986. Aetiology of diarrhoea in young calves. The Veter. Record., 119: 31‐34.
30. TORRES‐MEDINA, A., SCHLAFER, D.H., MEBUS, C.A., 1985. Rotaviral and coronaviral diarrhea. Vet. Clin. North. Am. Food. Anim. Pract., 1:471–93.
31. XIAO, L., FENG, Y., 2008. Zoonotic cryptosporidiosis. FEMS Immunology and Medical Microbiol., 52: 309‐323.
48
ASPECTS REGARDING VASCULOGENIC MIMICRY IN CANINE
MAMMARY CANCER
GAL A.F.1, CATOI C.1, BABA AI1, MICLAUS V.2, BOLFA P.1, TAULESCU M1, TABARAN F.1, NAGY A.1, MOUSSA R.1, Cosmina CUC
1Department of Pathology, Necropsy and Forensic Medicine 2Department of Histology
Faculty of Veterinary Medicine Cluj‐Napoca, 3‐5 Mănăştur Street, Romania, AGAL_77_2001@yahoo.com.
Abstract: This article describes and investigates intratumor angiogenesis in canine mammary tumors, respectively the presence of vasculogenic mimicry pattern of angiogenesis in canine mammary cancer. Vasculogenic mimicry suppose the forming of blood flowing channels in continuation of existing vessels especially in fast growing tumors with extended hypoxic areas. The channels are lined directly by tumoral cells that generate a PAS positive material to the inner part of the”vessel”. Mammary tumors had been provided by corps or tumor biopsies originated from different dog breeds and age. Detection and monitoring of intratumor angiogenesis and especially of blood flowing channels was evaluated using immunohistochemical LSAB reaction or/and double reaction, respectively immunohistochemical and PAS reactions. Elaborated work analyzed eight canine mammary tumors, respectively one benign and seven malign tumors. The occurrence of blood flowing channels was higher in vicinity of intratumor necrotic areas, knowing that hypoxia stimulate angiogenesis. Vasculogenic mimicry was notified more frequent in tumors with reduced stroma and numerous cancerous cells (compact mammary cancer), and in poorly differentiated canine mammary cancers. Some peculiarities of some blood flowing channels was represented by discreet immunohistochemical reaction that often was restricted only to a region of vascular wall not to all vessel’s circumference. Key words: angiogenesis, immunohistochemistry, PAS reaction, vasculogenic mimicry.
INTRODUCTION Vasculogenesis is a complex multistage process characterized by formation of new vessels from preexisting ones (1, 5, 7). Angiogenesis is essential for tumoral growing and metastasis, that’s why in more aggressive tumors the angiogenesis is more intense due to increased demands for newly formed structure. There are three main theories regarding intratumor angiogenesis, respectively (I) The theory of multistage angiogenesis, (II) The theory of cooption of preexisting vessels by the tumor, and (III) The theory of vasculogenic mimicry (1). Angiogenesis is a complex process that leads to generation of new capillaries from preexisting vascular network (multistage angiogenesis), or by forming of blood flowing channels delimited directly by tumoral cells (vasculogenic mimicry). Endothelial cell proliferation is 30‐40 folds higher in tumor structure comparing from normal tissues. Multistage angiogenesis begin with degrading of the basal membrane, followed by proliferation and migration of endothelial cells outside from the vessel structure. These cells are organizing into a tubular structure that forms
49
Lucrări Științifice – vol 53 seria Medicină Veterinară
some vascular buds originated in existing vessels. Finally, there it is formed a new blood vessel that supply a territory from tumor. Regarding the second theory of angiogenesis, the tumor entity subdue preexisting vessels, especially that ones from the periphery of tumor (1). The vasculogenic mimicry pattern of angiogenesis shows the plasticity and increased adaptability of tumoral cells to some injurious conditions such as hypoxia. This model is characterized by the formation of some PAS positive channels lined directly by tumoral cells not by endothelial cells, contributing in this manner to intratumor blood flow. Vasculogenic mimicry was firstly described in uveal melanoma, malignant astrocytoma, breast cancer, osteosarcoma, etc (21). There are many reports concerning intratumor angiogenesis and its importance in cancer progression and development. The vasculogenic mimicry pattern of tumor angiogenesis was and is an interesting idea that suggests the abilities of tumoral cells to avoid necrosis due to hypoxia. Vasculogenic mimicry was noticed also in cell cultures originated from aggressive melanomas; the cells had the abilities to form PAS positive channels without endothelium (4). Furthermore, some studies proved that presence of vasculogenic mimicry is related with unfavorable prognosis. Initially was thought that blood flowing channels are generated by stromal cells originated in fibrovascular septa (3, 6, 18), but subsequent was noticed that the channels are bordered directly by tumoral cells, which generate PAS positive material to the channel’s lumen (19).
MATERIAL AND METHODS
Mammary tumor formations had been provided by corps or tumor biopsies reached to Pathology department from the University of Agricultural Science and Veterinary Medicine, Faculty of Veterinary Medicine Cluj‐Napoca, Romania. There were utilized 7 malign and 1 benign tumors provided by different bitch breeds, such as: Cocker (3 subjects), Teckel (2 subjects), Amstaff (1 subject), German Sheppard (1 subject) and Mioritic Sheppard (1 subject). The mammary tumors are from 8 bitches, with the age of 2‐13 years.
Had been recorded several dates from anamnesis and tumoral characteristics (tumor size, consistence, gross section aspect, lymph nodes state). From the tumors and lymph nodes were harvested samples for histological exam avoiding tumoral necrotic or cystic areas, samples being immersed in buffered 10% formalin, and then process by paraffin technique. Slides were stained by usual techniques, respectively tricrom Masson and hematoxylin eosin. Mammary tumors were framed conformal to WHO classification for mammary tumors and graded into three types (from grade I‐less aggressive, to grade III‐high aggressivity). To establish histological grading was quantified the following: nuclear grade, mitotic index and extending of tubular structures in tumoral mass.
Detection and monitoring of intratumor angiogenesis and especially of blood flowing channels was evaluated using immunohistochemical LSAB reaction or/and double reaction, respectively immunohistochemical and PAS reactions. Immunohistochemical reaction used CD31 monoclonal antibody (Dako – clone JC70A, izotype IgG1 kappa). Histological slides had about 5 μm thicknesses and were fixed on silanized slides (Dako) during 24 hours in 37°C, followed by deparaffination in xylen. Antigen retriever had been made using a pressurized cooker in citrate solution, pH=6.0 (Dako); endogenous peroxidase was inactivated by peroxidase blocking reagent (Dako ‐ Peroxidase and PA blocking reagent 3%) during 5 minutes at the room temperature. Primary monoclonal antibodies (anti‐CD31) were maintained overnight, during 18 hours at 4°C, using a dilution of 1:30 (Dako antibody diluent). The visualization of immunological reaction was performed using Universal LSAB+Kit/HRP,
50
Lucrări Științifice – vol 53 seria Medicină Veterinară
Rb/Mo/Goat (DAB+) system (Dako); the counterstaining was performed by Mayer hematoxylin. To evaluate the antibody specificity were used negative control (replacing the primary antibody with antibody diluent) and internal positive tissue control (immunolabel of large vessels). Using PAS reaction may be highlighted mucopolysaccharides, which are present toward the inner part of the blood flowing channels. Double staining procedure (immunohistochemical and PAS reactions) had been realized at the end of immunohistochemical staining, before staining with Mayer hematoxylin. The slides were immersed in periodic acid (aqueous solution 0,5%) and Schiff reactive (30 minutes). Slides were rinsed with tap water and counterstained with Mayer hematoxylin.
To evaluate the microvessel number, perimeter and aria, we used a semiautomatic computerized analysis technique (Olympus Soft imaging solutions Cell B). There were analyzed 5 microscopic fields on every tumor, magnified of 200x. The microscopic images were obtained by Olympus BX51 microscope, connected to a photo digital camera (Olympus DP‐25). Total vascular aria (total intratumor area expressed in µm2/image area, and its percentage; average vessel area for each tumor), total vascular perimeter (average perimeter expressed in µm/image area), and the microvessel number were related to microscopic image area (144352,00 μm2). Any isolated but immunohistochemically labeled endothelial cell (vessels without lumen) was quantified as distinct microvessel.
PAS positive blood flowing channels from different canine mammary tumor types were examined by monitoring all clear spaces bordered PAS positive material and/or directly by tumoral cells. The occurrence of vasculogenic mimicry pattern was evaluated as follow: relatively frequent encountered (++), rarely met but present (+), and absent (‐).
RESULTS AND DISCUSSIONS
In 1948 in human pathology Willis et al. (1948) showed that some tumors with a fast
growing rate presents some channels similarly in structure with blood vessels but without endothelium (20). The author mentions the bordering of the channel directly by tumoral cells. Later this feature was termed vasculogenic mimicry, being encountered in several aggressive tumors (1, 3, 4, 6, 14, 19, 21). Nasu et al. (1999) describe a similar type of intratumor angiogenesis, describing some non‐endothelial channels where endothelial cells are scattered and without PAS positive material. The author considers these non‐endothelial channels something different from vasculogenic mimicry (15). Elaborated work analyzed eight canine mammary tumors, respectively one benign and seven malign tumors originated from different dog breeds of different age (2‐13 years). Tumor size varied from 0,35 cm until to 20 cm. There were elected several histologic types of malignant tumors, such as: more differentiated mammary tumors and highly aggressive mammary tumors; it is known that vasculogenic mimicry is more frequent in poorly differentiated cancers.
Regarding intratumor angiogenesis, there were studied the main parameters which indicate angiogenic profile of a tumor, such as: microvessel number/microscopic field area, total vascular area and perimeter, average vascular area and perimeter, the structure of vascular walls, intensity of immunohistochemical reaction in vessel’s wall. All of these were monitored to detect blood flowing channels and to debate intratumor angiogenesis. Double staining procedure (immunohistochemical and PAS reaction) made possible evidence of aspects regarding vasculogenic mimicry almost in all poorly differentiated tumors (cases 1, 2, 4, 5, 6, 7). Blood flowing channels were more obvious using this method comparing with the other CD31‐immunolabeling method. There should be mentioned that numerous blood
51
Lucrări Științifice – vol 53 seria Medicină Veterinară
flowing channels without endothelium were noticed in vicinity of intratumor necrotic areas (case 5), being known that hypoxia is a stimulus for angiogenesis.
The location of blood flowing channels occur in both, connective tissue stroma (cases 2, 4, 7) and between neoplastic cells in the case of compact tumors with scattered sustaining stroma and numerous tumoral cells (cases 5, 7). In blood flowing channels without endothelium from sustentacular connective tissue, the misinterpretation of some empty spaces to be considered blood channels is minimal using double staining procedure. Also, there can be noticed blood flowing channels in which immunohistochemical reaction is discreet or more often restricted to a limited portion of the vessel wall not to all vessel circumference how is normal in blood vessels with continuous endothelium (cases 4, 5, 6, 7). This aspect was also encountered by Nasu et al. (15). The PAS reaction highlights mucopolysaccharidic structure that line these channels, which don’t have endothelium (4, 14, 21). In many situations red blood cells can be seen into the channel’s lumen aiding with their notification.
Fig.1. Carcinoma in benign mixed tumor, grade II (case 8); double staining ‐ IHC anti‐CD31 and PAS reactions, counterstaining with Mayer’s hematoxylin x400.
52
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 2. Compact carcinoma, grade II (case 1.); blood vessel with discreet immunohistochemical reaction (arrow), labeling being not present to all circumference of the vessel; IHC reaction
anti‐CD31, counterstaining with Mayer’s hematoxylin x400.
Fig. 3. Cystic papillary mammary carcinoma, grade I (case 4) – presence of blood flowing channel (arrow), discreet IHC reaction anti‐CD31 (black arrow); counterstaining with Mayer’s
hematoxylin x 400.
53
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 4. Cystic papillary mammary carcinoma, grade I (case 4) – presence of blood flowing channel in continuity of blood vessel positive to IHC anti‐CD31; counterstaining with Mayer’s
hematoxylin x200.
Fig. 5. Solid anaplastic mammary carcinoma, grade III (case 7) – presence of blood flowing channel with red blood cells in lumen (light arrow) and of blood vessels with intense IHC reaction (black arrows); IHC reaction anti‐CD31; counterstaining with Mayer’s hematoxylin
x400.
54
Lucrări Științifice – vol 53 seria Medicină Veterinară
In tumors with reduced sustaining connective tissue, vasculogenic mimicry pattern may be easily recognized. In this tumor types, between malignant cells are obvious PAS positive channels from which some of them presents a discreet immunolabel of the wall, during some others have only mucopolysaccharides that line the channel (cases 5, 7). There are scattered fibroblasts (which can also produce these mucopolysaccharides), indicating this material is generated directly by tumoral cells lining the “sanguine vessels” without endothelium. Described aspect is known in the literature as vasculogenic mimicry, showing once again the plasticity and adaptability of malignant cells. This feature reveals the ability of malignant tumor to find “solutions” to minimize or to avoid intratumor necrosis.
The presence or not of vasculogenic mimicry was correlated with histologic grade, and also with vascular parameters (intratumor microvessel density, average microvascular area and perimeter). The presence of blood flowing channels was directly related with histologic grade, such as: the pattern is more frequent encountered (++) in grade II and III canine mammary cancers (cases 5, 6, 7), and less extended in (+) in grade I mammary tumors (cases 2, 4) and in some of poorly differentiated (grade II) mammary tumors (case 1); vasculogenic mimicry wasn’t encountered in benign mammary tumor (case 3) and interestingly in one grade II malign mammary cancer (case 8). Described aspects show that vasculogenic mimicry is more prevalent in poorly differentiated canine mammary cancers (grade II and III tumors) and less frequent or absent in more differentiated ones or in benign tumors.
Regarding the incidence of vasculogenic mimicry depending of histologic type of canine mammary tumor, the prevalence is higher in solid carcinomas (cases 1, 5, 7 – 37,5%), followed by carcinoma in benign mixed tumor (case 2 – 12,5%), simple tubule‐papillary carcinoma (case 6 – 12,5%), and papillary‐cystic carcinoma (case 4 – 12,5%).
Fig. 6. Solid mammary carcinoma, grade III (case 5) – presence of numerous blood flowing channels with PAS positive material toward the lumen missing IHC reaction (light arrow), and
numerous isolated IHC positive endothelial cells into tumor mass (black arrows); double staining – IHC anti‐CD31 and PAS reactions, counterstaining with Mayer’s hematoxylin x200.
55
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 7. Solid mammary carcinoma, grade III (case 5) – presence of numerous blood flowing channels with PAS positive material toward the lumen missing IHC (arrows); tumoral cells
border direcly the channels; double staining – IHC anti‐CD31 and PAS reactions, counterstaining with Mayer’s hematoxylin x400.
By comparing the relation between vasculogenic mimicry and intratumor microvessel
density (IMD), blood flowing channels have a higher occurrence in tumors with an increased number of microvessels/microscopic field (cases 1, 6). Thus, blood flowing channels without endothelium were more frequent prevalent in malignant tumors with IMD between 18,2‐49,2 (cases 1, 2, 4, 5, 6, 7). The bibliography rapports indicate an association between an increased intratumor microvessel density and a faster development of the tumor, being also correlated to a reduced survivor rate (13, 16, 17). On the other hand there are some reports where, statistically, weren’t find correlations between IMD and tumoral aggressivity (8‐11).
Regarding the other vascular parameters (total microvascular area and perimeter), there weren’t established interrelations with vasculogenic mimicry. Despite of that, a quite interesting thing was noticed as follow: in mammary cancers that had numerous vessels with reduced perimeter and area (average vascular perimeter and area) vasculogenic mimicry occurrence is higher. Also, it was observed that mammary tumors where predominate microvessels with small caliber (implicitly with reduced vascular perimeter and area) had the most numerous blood flowing channels without endothelial lining (cases 5, 6, 7). By increasing the values of average vascular area and perimeter, the frequency of vasculogenic mimicry pattern is rarely encountered (cases 1, 2, 4). Domination of newly formed microvessels of reduced caliber indicates an increased intratumor angiogenesis and, on the other hand, an increased risk for tumoral growing.
56
Lucrări Științifice – vol 53 seria Medicină Veterinară
Table 1. General aspects regarding intratumor angiogenesis in different canine mammary tumors.
Case nr.
Histologic diagnose
Histologic grade
Mitotic index
Intratumor angiogenesis VM
IMD TMA (%)
MP Sum
Average MA
Average MP
1 Solid carcinoma
II 19 27 5.81 2492.59
310.93 92.32 +
2 Tubule‐papillary carcinoma in benign mixed tumor
I 5 18.2 5.36 2013.46
425.89 110.63 +
3 Adenoma ‐ ‐ 14.8 2.26 1140.75
221.20 77.08 ‐
4 Cystic‐papillary carcinoma
I 14 22.6 6.07 2250.75
388.17 99.59 +
5 Solid carcinoma
III 24 24.4 2.34 1540.16
166.76 63.12 ++
6 Tubulopapillary carcinoma
II 33 49,2 5,40 3085,68
158,72 62,72 ++
7 Solid anaplastic carcinoma
III 13 22.33
3.28 1760.94
212.56 78.85 ++
8 Carcinoma in benign mixed tumor
II 12 18,8 4,10 1876.28
314,96 99,80 ‐
IMD: Intratumor microvessel density (microvessel number)/area of microscopic image. TMA: Total microvascular area (%)/area of microscopic image – average value obtained by
monitoring five microscopic fields magnified of media 200x. MA: Microvascular area (μm2) ‐ average value obtained by monitoring five microscopic fields
magnified of media 200x. MP: Intratumor microvessel perimeter (μm) ‐ average value obtained by monitoring five
microscopic fields magnified of media 200x.
The new findings regarding angiogenesis deliver some important and useful dates not only about growing rate and prognosis, but also to improve antitumoral therapeutic protocols some of them involving the destruction of blood vessels which supply the neoformation. Anti‐angiogenic therapies may be realized using natural or synthetic inhibitors of angiogenesis, such as angiostatin, endostatin, tumtatina, etc. Endothelial cells were and are considered, genetically, more stable structure than cancerous cells. This genomic stability confers an advantage in elaboration of antitumoral therapies that have as target endothelial cells using anti‐angiogenic agents. Because of that, endothelial cells may represent ideal targets for antitumor therapy. Nevertheless, antitumor therapheutic protocols using antiangiogenic agents (targeting vascular endothelium) may be useles for cancerous areas where the vascularisation occur using vasculogenic mimicry, which don’t have endothelium.
57
Lucrări Științifice – vol 53 seria Medicină Veterinară
CONCLUSIONS 1. Utilizing either double staining procedure (immunohistochemical anti‐CD31 and PAS reactions) or single immunohistochemical anti‐CD31 technique made possible notification of vasculogenic mimicry in highly aggressive tumors, such as grade II and III canine mammary cancer. Nonendothelial blood channels were less extended to differentiated tumors, practically being absent in benign tumor. 2. The occurrence of blood flowing channels was higher in vicinity of intratumor necrotic areas knowing that hypoxia stimulate angiogenesis. 3. Vasculogenic mimicry was notified less frequent in sustaining connective tissue and more frequent in tumors with reduced stroma and numerous cancerous cells, such as compact carcinomas and simple carcinomas. 4. Some peculiarities of some blood flowing channels were represented by discreet immunohistochemical reaction that often was restricted only to a region of vascular wall not to all circumference of the vessel. This indicates that some vessels are incompletely lined by endothelial cells, the rest of the vessel’s lumen being bordered by tumoral cells. Furthermore, PAS reaction highlighted mucopolysaccharides which lined the channels without endothelium. 5. Occurrence of blood flowing channels was higher in tumors with increased microvessel density/microscopic field, and in tumors that had numerous microvessels with reduced caliber, both features indicating increased intratumor angiogenesis and alert tumor growth. BIBLIOGRAPHY
1. Baba A.I., Cătoi C., 2007 – Comparative Oncology, Romanian Academy Ed, pg. 423 ‐ 447. 2. Blood C.H., Zetter B.R., 1990 ‐ Tumor interaction whit the vasculature: angiogenesis and tumor
metastasis. Biochim. Biophys. Acta., 1032, 89‐118. 3. Clarijs R., Otte‐Holler I., Ruiter D.J., de Waal R.M., 2002 ‐ Presence of a fluid‐conducting meshwork in
xenografted cutaneous and primary human uveal melanoma. Invest Ophthalmol Vis Sd.;43:912‐918. 4. Folberg R., Hendrix M. J. C., Maniotis A. J., 2000 ‐ Vasculogenic Mimicry and Tumor Angiogenesis, Am.
J. of Pathology, vol. 156, No. 2. 5. Folkman J., 1995 ‐ Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med, 1:27‐31. 6. Foss A.J., Alexander R.A., Hungerford J.L., Harris A.L., Cree I.A., Lightman S., 1997 ‐ Reassessment of
the PAS patterns in uveal melanoma. Br J Ophthalmol, 81:240–246. 7. Fox S.B., Gatter K.C., Harris A., 1996 ‐ Tumour angiogenesis. J. Pathol., 179, 232–237. 8. Gal A., C. Cătoi, I. Iulia Robu, Baba A.I., Miclaus V., Rus V., Taulescu M., Bolfă P., 2009 – Correlation
between intratumor microvessel density and Ki‐67 malignancy marker in bitch mammary cancer, Buletin USAMV‐CN, 66 (1)/2009, ISSN 1843‐5270: 55 ‐ 62.
9. Gal A., C. Cătoi, I. Rus, M. Taulescu, P. Bolfă, I. Lakatos, A.I. Baba, 2008 – The study of vascularisation in bitch mammary tumors, Buletin USAMV‐CN, 65 (1)/2008, ISSN 1843‐5270: 388 ‐ 394.
10. Gal A., C. Cătoi, I., A.I. Baba, V. Miclaus, Daniela Cerbu, I. Lakatos, 2009 – Relationship between PCNA proliferating marker and Angiogenesis in bitch mammary cancer, Buletin USAMV‐CN, 66 (1)/2009, ISSN 1843‐5270: 490.
11. Gal A., Hener Adriana, A.I. Baba, C. Catoi, I. Rus, 2007 – Prognosis significance of intratumor microvessel density in bitch and cat mammary tumors, Bulletin USAMV‐CN, vol. 64 (1‐2): 151, print ISSN 1843‐5270, electronic ISSN 1843‐5378.
12. Hashizume H., Baluk P., Morikawa S., McLean J.W., Thurston G., Roberge S., Jain R.K., McDonald D.M., 2000 ‐ Openings between defective endothelial cells explain tumor vessel leakiness. Am J Pathol, 156:1363‐1380.
13. Luong R.H., Baer K.E., Craft D.M., Ettinger S.N., Scase T.J., Bergman P.J., 2006 ‐ Inttratumoral microvessel density and canine STS, Vet. Pathol., 5‐43.
58
Lucrări Științifice – vol 53 seria Medicină Veterinară
14. Maniotis A.J., Folberg R., Hess A, Seftor E.A., Gardner L.M., Pèer J., Trent J.M., Meltzer P.S., Hendrix M.J., 1999 ‐ Vascular channel formation by human melanoma cells in vivo and in vitro: vasculogenic mimicry. Am J Pathol, 155:739‐752.
15. Nasu R., Kimura H., Akagi K., Murata T., Tanaka Y., 1999 ‐ Blood flow influences vascular growth during tumour angiogenesis. Br J Cancer, 79:780–786.
16. Page D., Jensen R., 1995 ‐ Angiogenesis in human breast carcinoma; what is the question? Hum. Pathol., 26: 1173‐1174.
17. Restucci B., De Vico G., Maiolino P., 2000 ‐ Evaluation of angiogenesis in canine mammary tumors by quantitative platelet endothelial cell adhesion molecule immunohistochemistry. Vet. Pathol.,37: 297‐301.
18. Ruiter D., Bogenried T., Elder D., Herlyn M., 2002 ‐ Melanoma‐stroma interactions: structural and functional aspects. Lancet Oncol.3:35‐43.
19. Wei‐Ying Y., Zhong‐Ping C., 2005 ‐ Does Vasculogenic Mimicry Exist in Astrocytoma?, J Histochem Cytochem 53:997–1002.
20. Willis R.A., 1948 ‐ Pathology of Tumours. London, Butterworth & Co., Ltd., p 136. 21. Zhenhong X.; Yongwei J.; Xuansong C.; Jiong M.; Liming C.; Guangrong Y., 2008 ‐ Vasculogenic
Mimicry in Osteosarcoma : Histomorphologic Studies in Vivo and in Vitro; Tang Ruyong Bioinformatics and Biomedical Engineering, Page(s): 915 – 918.
59
ASSESSMENT OF THE ANTI‐INFLAMMATORY ACTION OF THE
CARPROFEN‐BETA CYCLODEXTRINS COMPLEX ON EXPERIMENTAL INFLAMMATION MODEL IN RATS
GRECU Mariana1, NĂSTASĂ V.1, MAREŞ M.1, MORARU Ramona1,
HRIȚCU Luminița Diana1, ILIE Cornelia2 1USAMV Iassy, Faculty of Veterinary Medicine
2Institute of Physical Chemistry “Ilie Murgulescu” Bucharest marianagrecu_drd@yahoo.com
Abstract:The main aim was the comparative testing of the carprofen and carprofen‐β cyclodextrin using an experimental inflammation model in rats. The improvement of carprofen bioavailability was tested by complexing it with β‐cyclodextrin, as carrier molecules, in the conditions of dosage reduction to limit the side effects that are common in NSAIDs therapy (dyspepsia, gastritis, ulcerations etc.). The obtained results sustain a higher therapeutical efficacy/non‐inferiority of carprofen‐beta cyclodextrins over carprofen only.
Key words: carprofen, β‐cyclodextrin, experimental model, inflammation, rat
INTRODUCTION
The efficacy of many active ingredients is limited by their capacity to reach the target
site. In most of the cases, only a small quantity of the administered dose reaches this site, while the rest of the dosage is distributed throughout the body, depending on the physico‐chemical and biochemical properties of the molecule (2).
Most of the molecules in the active ingredient, such as: non ‐ steroidal anti ‐ inflammatories (NSAIDs), antifungals, antiparasitic drugs etc., are insoluble in a aqueous environment, which leads to a major problem in their conveyance and absorption. Furthermore, these molecules are showing a high toxicity degree towards the major structures of the body (especially towards the digestive system, liver and kidney). To avoid these drawbacks, the use of some carrier molecules, that can improve the bioavailability of the active ingredients and reduce the side effects, has been considered necessary. Therefore, during the last years, there has been a rise in interest towards the interactions between different active substances and ciclodextrines – natural polymers ( 1, 3, 4), that could enhance the drugs’ therapeutical properties, lowering as much as possible their toxicity and rising their efficiency.
In this study, we have observed and evaluated the effectiveness of the combination carprofen – β cyclodextrin compared to the administering of carprofen, in a model of experimental inflammation.
60
Universitatea de Științe Agricole și Medicină Veterinară Iași
METHODS AND EQUIPMENT
The study used 18 young male white rats, Wistar, weighting 200 ± 10 grams, acquired
from the Cantacuzino Institute, Bucharest, that have been bred in a germ‐free environment and to whom has been induced a plantar inflammation, in the hind right paw, by injecting an aqueous suspension of kaolin 10%, intraplantary, 0.15ml per rat. The animals were then divided in 3 groups, with 6 rats in every group (n = 6), group A – the control group, group B, in which carprofen has been administered per os, in a dose of 5mg/kg, and group C whose individuals were administered, per os, 2.5mg/kg of the carprofen – β cyclodextrine complex, both substances being administered once a day, with a feeding tube, for two days. The carprofen – β cyclodextrine complex has been prepared at the Macromolecular Chemistry Institute „Petru Poni” in Iassy, through lyophillization.
Before inducing the inflammatory process, every rat’s hind right paw has been marked near the point where the paw was completely immersed in the measuring cell. After marking, the paw diameter has been measured and calculated, using pletysmography; the procedure was repeated after inducing the inflammation after 1, 3, 6, 9, 12, 24 and 48 hours, following the dynamics of the inflammatory process and evaluating through pletysmography the differences between the groups.
After 9 – 12 hours since the inducing of the inflammation, blood was collected in vials containing clot activators, for determining the C reactive protein (CRP), an important marker in acute inflammatory processes. The samples have been placed in the centrifuge at 8000 rpm for 2 minutes and then were placed in the refrigerator at a temperature of +4˚C for 48 hours, because the analyze of CRP requires stable serum samples.
All the experimental procedures used in this study have been in accordance to international ethical regulations regarding the manipulation and use of laboratory animals, using the method recommended by OECD guidelines for the Testing of Chemicals 425/17.12.2005.
RESULTS
When measuring the paw diameter, before administering the substances, the values obtained were 1.0 – 1.1 cm3, with minor variations between the rats from the 3 groups.
The inflammation had a rapid onset and course, so that 9 hours after the exposure to the inflammatory stimulus, considered the peak moment of inflammation, paw diameters had increased greatly in the control group rats and those treated with carprofen and less in rats treated with carprofen + β cyclodextrin complex (image 1).
61
Universitatea de Științe Agricole și Medicină Veterinară Iași
Figure 1. Dynamic of the inflammatory process at 9 hours
a b
c
Figura 2. Diameter of path at 9 hours: a) control; b) group treated with carprofen; c) group treated with cu carprofen + β ciclodextrină
These values were maintained in a plateau period of several hours ‐ between 9 and
12 hours since the exposure – then the inflammatory edema began regressing with ease, at a slow pace, in comparison with its appearance speed, immediately after the stimulus trigger. Clinical symptoms were manifested by marked congestion of the paws, the local temperature and increased pain sensitivity, keeping a suspended position of the member, functional impotence, and were correlated with marked impairment of general status of rats (image 2).
At 24 hours after induction of inflammation in group C treated with carprofen + β cyclodextrin, when measuring the paw diameter through pletysmography, the result showed a significant regression of the edema and also a decrease in congestion, the local temperature and pain sensitivity, animals resumed their daily activities ‐ grooming, food and water
62
Universitatea de Științe Agricole și Medicină Veterinară Iași
consumption. In group B, treated with carprofen, the rate of the edema reduction was moderate, but significantly faster compared to the rats in the control group, where paw edema was prominent and had a slow regression (Figure 2).
After 48 hours, the inflammation was still present in the control group, the pletysmographic measurements showing a 60% decrease of the edema (Figure 2).
Figure 2. Dynamic of the inflammatory process at 48 hours
The results showed a significant difference between control group and groups of rats treated with NSAIDs, especially for the group treated with carprofen + β cyclodextrin, where the complex efficacy was observed through the rapid inhibition of paw edema. Anti‐inflammatory effect of the complex was found to be maximum at 6‐8 hours after administration, producing an inhibition of the occurrence of the inflammation in approximately 40% of the individuals, compared to 20% of rats showing a response in the group treated with carprofen and no evident response in the control group.
For detecting C reactive protein (CRP), the latex agglutination test was used. Determination of protein C results in our study showed positive results in a small number of animals from the three batches (only eight positive samples from a total of 18 rats), especially in the control group where there was evidence of serum agglutination in all six rats. In the group treated with carprofen, positive results were evident only in two rats, the remaining samples being negative, and in group C which received carprofen complexed with β cyclodextrin, in all 12 rats the CRP results were negative.
Serum samples that gave positive results in qualitative screening evidencing agglutination presence after two minutes since the homogenization of the mixture, were taken to determine titres, taking the quantitative variant of the test. Thus, in samples from the rats in control group the agglutination was observed as far as the dilution ¼, the titer being 24 mg/l CRP, and the positive samples from the rats in group treated with carprofen, agglutination was observed as far as the dilution ½, value titer being 12 mg/l CRP. Thus,
63
Universitatea de Științe Agricole și Medicină Veterinară Iași
elevated titres in test ‐ detectable CRP is an argument towards the presence of high concentrations of proteins pertaining the inflammatory process in serum.
The pletysmography measurements used in our experimental studies have allowed, as much as possible, accurate and sensitive measurements of plantar edema. Using this modern method has particularly proved the influence that carprofen complexed with cyclodextrin have on acropodium edema in rats after intraplantary injections with kaolin, 10% aqueous suspension. The results are consistent with literature data (5), which is considered encouraging for using this protocol in order to validate the test method inflammatory products.
CONCLUSIONS
1. Experimental models of inflammation induction gave significant results to assess the effectiveness of NSAIDs, both complexed with beta cyclodextrin and simple.
2. It was noted that in this model of plantar inflammation, rats have a clear local reaction that is significant from pharmacokinetic and pharmacodynamic point of view.
3. Experimental studies have confirmed the efficacy of carprofen ‐ cyclodextrin complex, even if the dose was lower (2.5 mg) compared with the group that was treated with carprofen at a dose of 5 mg / kgcorp.
BIBLIOGRAPHY
1. Fu‐An Chen, An‐Bang Wu and Chau‐Yang Chen, 2003 ‐ Inclusion Complex of Carprofen with Hydroxypropyl‐β‐cyclodextrin Journal of Inclusion Phenomena and Macrocyclic Chemistry 46: 111–115.
2. Goodman and Gilman's, 2006 ‐ "The pharmacological Basis of Therapeutics", 11th ed., (Laurence L. Brunton, John S. Lazo, Keith L. Parker); Mc Graw ‐ Hill, New – York, Saint Louis, San Francisco, p. 671‐685,687‐705.
3. Jicsinszky L., Petrikovics I., Petro M., Horvath G., Szejtli J., Way JL., 2007 ‐ Improved drug delivery by conjugation with cyclodextrins. Proceedings of 14th European Carbohydrate Symposium, September 2–7, Lubeck, Germany.
4. Thorsteinn Loftsson, Dominique Duch, 2007 ‐ Cyclodextrins and their pharmaceutical applications. International Journal of Pharmaceutics 329, 1–11.
5. Vlase E., Coman C., Szegli G., Lupu Andreea‐Roxana, Cremer Lidia, Barzu Natalia Simona, Badulescu Maria‐Mihaela, Calugaru Ana, Ionescu G., 2008 ‐ „Pletismometria computerizată – metodă performantă de măsurare a edemului inflamator acut indus la şoarece prin injectarea intraplantară de Carrageenan”, Sepsis Granada, Spania, 19‐22 Nov.2008 si Sesiunea de Comunicari Stiintifice a INCDMI Cantacuzino, ianuarie 2009.
64
EVALUATION OF DEGREE OF ENGRAFTMENT IN MOUSE
MODEL OF STEM CELLS HARVESTED FROM HUMAN PLACENTA
Groza I.Ș, Groza Daria, Pall Emoke, Cenariu M., Ciupe Simona, Laura
Parlapan University of Agricultural Science and Veterinary Medicine,
Cluj‐Napoca, 3‐5 Manastur street, Cluj‐Napoca, isgroza@yahoo.com
Abstract: Recent interest in stem cell biology and its therapeutic potential has led to the search for accessible new sources of stem cells. Fetal stem cells from umbilical cord blood and placenta are less ethically contentious than embryonic stem cells and their differentiation potential appears greater than adult stem cells. Fetal stem cells represent powerful tools for exploring many aspects of cell biology and hold considerable promise as therapeutic tools for cell transplantation. In this study, we established a mouse model for in utero transplantation of human placental mesenchymal stem cells (hPMCs) to investigate if these cells would affect long‐term, organ‐specific engraftment.
KEYWORDS: placenta, mesenchymal stem cells, engraftment, prenatal diagnosis Early prenatal diagnosis and in utero therapy of certain fetal diseases have the
potential to reduce fetal morbidity and mortality. The intrauterine transplantation of stem cells provides in some instances a therapeutic option before definitive organ failure occurs. Clinical experiences show that certain diseases, such as immune deficiencies or inborn errors of metabolism, can be successfully treated using stem cells derived from bone marrow. However, a remaining problem is the low level of engraftment that can be achieved. Efforts are made in animal models to optimize the graft and study the recipient’s microenvironment to increase long‐term engraftment levels. It is known that some diseases, such as haemoglobinopathies (Fanconi’s anaemia, thalassaemia), immunological defects (SCID) or certain inborn errors of metabolism can be treated by transplantation of stem cells (Shapiro E. et al., 2000). If the stem cell transplantation is performed before symptoms of the disease occur, organ function can be preserved (Newsome P.N. et al., 2003). However, if transplantation is performed after delivery of the baby, intensive immunosuppression and myoablation have to be used to minimize the risk of Graft‐versus‐host disease and to empty the bone marrow.
Cells of different origins have been used for in utero transplantation in a number of models. Human bone marrow‐derived mesenchyamal stem cells have been transplanted into fetal sheep and shown to persist for as long as13 months with multilineage differentiation potential (Liechty et al., 2000).
In this study, we established a mouse model for in utero transplantation of human placental mesenchymal stem cells to investigate if these cells would affect long‐term, organ‐specific engraftment.
65
Lucrări Științifice – vol 53 seria Medicină Veterinară
MATERIALS AND METHODS Biological material, clinically normal human term placentas (37– 40 weeks of
gestation, n =3) were collected after Cesarean section. Placentas were obtained after informed consent of the women, and all experiments were approved by the ethics committee of the University of Medicine and Pharmacy Iuliu Hatieganu Cluj‐Napoca. Term placentas from healthy donor mothers were obtained with informed consent approved according to the procedures of the institutional review board. The harvested pieces of tissue were washed several times in phosphate‐buffered saline (PBS) and then mechanically minced and enzymatically digested with 0.25% trypsin‐EDTA (Gibco) for 30 min at 37° C. After centrifugation the cell suspension was filtered to eliminate undigested fragments. For lysis the erythrocytes, cells suspensions were treated with FACS Lysing Solution 10x (BD Biosciences) for 15 min. The suspension pelleted by centrifugation (1500 rpm/7 min) and suspended in propagation medium, which consist of Dulbecco’s Modified Eagle’s medium (Gibco) supplemented by 10 % fetal calf serum (FCS), 100 U/ml penicillin‐streptomycin (Gibco).
Cultures were maintained in DMEM with 10% fetal bovine serum (FBS; Hyclone, USA) at 37° C with 5% CO2. Approximately 2 – 3 weeks later, some colonies consisting of fibroblast‐like cells were observed. These cells were trypsinized and replated for expansion. In order to obtain single cell‐derived hPMC clones, cells were serially diluted in 96‐well culture plates (BD Biosciences) at a final density of 60 cells/ plate. Colonies that grew with homogeneous bipolar morphology were expanded.
Identification of cell phenotypic markers by FACS (Fluorescence‐Activated Cell Sorter) passage 5. After the second passage, the cells were trypsinised (0.25% trypsine EDTA), washed twice with PBS and stained according to the recommendation of the manufacturer with the monoclonal antibodies, FITC‐CD44, examined with a FACS CantoII Apparatus (Becton–Dickinson). For in utero transplantation of mesenchymal stem cells from placentas, were prepared single cell suspensions. On day 13.5 after mating, pregnant mice were anesthetized with avertin. Under aseptic conditions, the uterine horns were exposed, and donor cells were injected through a glass micropipette (inserted through the uterine wall and into the peritoneal cavity of each fetus under direct visualization. The injection consisted of 1 x 106 hPMCs in 5 µl of PBS. The abdominal incision was closed in two layers using 4‐0 silk, and the mice were allowed to complete pregnancy to term.
On E20, a low abdominal midline incision was made and the number of live fetuses in each uterine horn was recorded. Then, placenta, fetal blood and fetal organs including brain, heart, lung, liver, spleen and bone marrow were collected. To obtain single cell suspension as chopped tissues were processed by the Medimachine device. For evidence of placental stem cells in mice organs the samples were treated with 20 µl fluorescent antibody (anti ‐ human CD45 PE‐Cy5 antibody (PE‐Cy5: phycoerythrin‐Cy5), (FITC: fluorescein isothiocyanate), anti – human CD34‐FITC antibody (FITC: fluorescein isothiocyanate) and anti‐ human CD44 antibody). Have prepared two samples for each antibody in the study: a sample and a sample labeled with antibody as blank unmarked. For positive control were used MSCs isolated from placenta and CD34 + cells from cord blood.
RESULTS AND DISCUSSION
To show that hPMCs injected in utero on E13.5 engrafted in fetal organs, we collected
fetal organ samples at E20. Most fetal tissues had demonstrable hPMC engraftment at E20. Although the distribution pattern and numbers of cells in individual fetuses varied, hPMCs
66
Universitatea de Științe Agricole și Medicină Veterinară Iași
were detectable in more than 60% of the fetus. The first experiment conducted fetal loss rate was high: 93.75% most likely due to lack of experience in producing labor in utero transplantation. Engraftment analysis was done using FACS Diva software and results are presented as histograms. We assessed the presence of hPMCs in various fetal mouse tissues (fig.1, 2, 3, 4).
Figure 1 – Flow cytometric analysis of hPMCs in the mouse fetus after in utero transplantation
of hPMCs
Figure 2 – Histogram representation of engraftment
67
Lucrări Științifice – vol 53 seria Medicină Veterinară
Figure 3 – Histogram representation of engraftment of human mesenchymal stem cells
Figure 4 – Histogram representation of engraftment in negative and positive control
Trans species animal models have been widely used in the study of stem cell
migration and engraftment (Liechty et al., 2000; Saito et al., 2002). It has been shown that human cord blood‐derived cells can differentiate into hepatocytes in the mouse liver without evidence of cellular fusion (Newsome et al., 2003). Human microchimerism was observed in various organs and tissues at 4 months after transplan‐tation of human amnion and chorion mesenchymal progenitors in neo‐natal swine and rats (Bailo et al., 2004). Human mesenchymal stem cells colonized multiple fetal sheep tissues for as long as 13 months after in utero transplantation (Liechty et al., 2000). Differences observed in cell numbers may be due to colonization efficiency in different tissue environments or the rate of cell turnover in each organ (Krause et al., 2001). Our study adds to this body of work by establishing an in utero (E13.5) model of xenogeneic hPMC transplantation in immunocompetent mice.
68
Universitatea de Științe Agricole și Medicină Veterinară Iași
CONCLUSIONS
Mesenchymal stem cells (MSCs) are widely distributed in a variety of tissues in the adult human body (e.g., bone marrow, kidney, lung, and liver). These cells are also present in the fetal environment (e.g., blood, liver, bone marrow, and kidney). However, MSCs are a rare population in these tissues. The most well studied and accessible source of MSCs is bone marrow, although even in this tissue the cells are present in a low frequency.
The human placenta is an attractive new source of mesenchymal stem cells (MSCs), but the biological characteristics of placenta‐derived MSCs have not yet been characterized. Our results show that mesenchymal stem cells are present in the human term placenta and may be a potential source of cells for transplantation therapy. Using routine cell culture techniques, placental derived mesenchymal stem cells can be successfully isolated and expanded in vitro.
Mesenchymal stem cells are mainly derived from bone marrow (Orlic et al., 2001), but it may be difficult to obtain sufficient autologous cells from some patients, particularly those who are older or who have malignancies. Therefore, alternative sources are needed. It appears that hPMCs from an allogeneic donor might constitute such a source. A further potential benefit is the exposure of the fetus to allogeneic cells, inducing tolerance such that future treatment.
BIBLIOGRAPHY 1. Bailo M, Soncini M, Vertua E, Signoroni PB, Sanzone S, Lombardi G, Arienti D, Calamani F, Zatti D,
Paul P et al. Engraftment potential of human amnion and chorion cells derived from term placenta. Transplantation 2004;78:1439 – 1448:
2. Carolyn Troegera, Daniel Surbeka, Andreina Schöberleina, Stephan Schatt, Lisbeth Dudlera, Sinuhe Hahna, Wolfgang Holzgreve, In utero haematopoietic stem cell transplantation, SWISS MED WKLY2006;136:498–503
3. Krause DS, Theise ND, Collector MI, Henegariu O, Hwang S, Gardner R, Neutzel S, Sharkis SJ. Multi‐organ, multi‐lineage engraftment by a single bone marrow‐derived stem cell. Cell 2001;105:369– 377
4. Liechty KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW. Human mesenchymal stem cells engraft and demonstrate site‐specific differentiation after in utero transplantation in sheep. Nat Med 2000;6:1282 – 1286:
5. Liechty KW,MacKenzie TC,Shaaban AF, Radu A,Moseley AM, Deans R, Marshak DR, Flake AW. Human mesenchymal stem cells engraft and demonstrate site‐specific differentiation after in utero transplantation in sheep. NatMed 2000;6:1282–1286.
6. Newsome PN, Johannessen I, Boyle S, Dalakas E, McAulay KA, Samuel K, Rae F, Forrester L, Turner ML, Hayes PC et al. Human cord blood‐derived cells can differentiate into hepatocytes in the mouse liver with no evidence of cellular fusion. Gastroenterology 2003;124:1891 –1900;
7. Orlic D, Kajstura J, Chimenti S, Jakoniuk I, Anderson SM, Li B, Pickel J, McKay R, Nadal‐Ginard B, Bodine DM et al. Bone marrow cells regenerate infarcted myocardium. Nature 2001;410:701– 705;
8. Saito T, Kuang JQ, Bittira B, Al‐Khaldi A, Chiu RC. Xenotransplant cardiac chimera: immune tolerance of adult stem cells. Ann Thorac Surg 2002;74:
9. Shapiro E, Krivit W, Lockman L, et al. Long‐term effect of bone‐marrow transplantation for childhood‐onset cerebral X‐ linked adreno‐leukoldystrophy. Lancet 2000;356:713–8.
69
PRELIMINARY STUDY ON THE PREVALENCE OF TOXOPLASMA GONDII INFECTION IN WILD BOARS FROM TIMIS COUNTY
Ionela HOTEA¹, Gh. DARABUS¹, C. PACURAR², Tatiana RUGEA², P. MUNTEAN², M.S. ILIE¹, K. IMRE¹,
Mirela IMRE¹, Denisa SORESCU¹, Adrian BALINT¹, Dinu INDRE¹
¹ Faculty of Veterinary Medicine, No. 119, Calea Aradului, Timisoara, Romania ² DSVSA Timis, No. 4, Surorile Martire Caceu, Timisoara, Romania
hotea_ionela@yahoo.com
Abstract: 52 blood samples from wild boars were studied to determine the seroprevalence of Toxoplasma gondii infection. The animals came from different animals hunting areas from Timis County.Serum samples were examined by ELISA method. Of the 52 samples from wild boars, 49 of them (94.23%) had anti‐Toxoplasma Ig G antibodies.
Key words: Toxoplasma gondii, wild boars, prevalence, Timis County
Toxoplasmosis is one of the most common parasitosis in humans and animals, it being placed on the top three global spread (4). The cat is the key element in the epidemiology of toxoplasmosis (6). For toxoplasmosis transmission, a very important role it have raw meat consumption. In pigs, infection occurs by eating kitchen scraps unsterilized or rodents. In certain circumstances, pigs become cannibals biting their tails or ears. T. gondii tissue cysts of wild boar meat are considered sources of infection for humans (9).
Necropsy diagnosis in the slaughterhouse, it is very difficult to done, because very small necrotic lesions are difficult to observe. Serological diagnosis is possible to made in the slaughterhouse, but is not warranted in our economic Country's conditions (3).
Reporting an increased incidence of toxoplasmosis in humans and animals worldwide and the small number of bibliographic data in our Country about Toxoplasma infection, motivates our study. MATERIALS AND METHODS
The 52 blood samples collected from wild boars, between 2008‐2009, were sent by AJVPS representatives (County Association of Hunters and Fishermen Sports) Timis at DSVSA (Department Veterinary and Food Safety) for other types of analysis. The animals were hunted in Timis County, in different localities (FV – hunting areas), as follows:
3 wild boars – Buzias, 3 wild boars – Brestovat, 5 wild boars – Surduc, 4 wild boars – Buzias, 3 wild boars ‐ Ohaba Lunga, 4 wild boars – Paniova, 6 wild boars ‐ Sacosu Mare, 5 wild boars ‐ Cheveresu Mare, 3 wild boars ‐ Racovita, 4 wild boars – Secas, 4 wild boars – Culina,
70
Lucrări Științifice – vol 53 seria Medicină Veterinară
5 wild boars – Zolt, 3 wild boars ‐ Topolovatu Mare. Collected blood was left to express serum and it was kept in a freezer until the month of
November 2009 when samples were processed in the laboratory of Parasitology and Parasitic Diseases of Faculty of Veterinary Medicine of Timisoara.
Serum samples were examined by indirect ELISA method using ID Screen Multi‐species kit (ID.VET., France) for anti‐Toxoplasma specific Ig G antibodies, resulting from infection with Toxoplasma gondii. Kit can be used for determination of anti‐Toxoplasma specific Ig G antibodies from sera of ruminants, pigs and cats. We respect technology manufacturing indicates by producer company.
The S/P values above 200% were considered strongly positive, between 50 and 200% samples were considered positive, between 40% and 50% were doubtful, while values below 40% were considered negative.
RESULTS AND DISCUSSIONS
From Timis County were collected and examined 52 serological samples from wild boars. Of processed serum samples from wild boars, 49 of them (94.23%) had anti‐Toxoplasma Ig
G antibodies. Antibody titre values were between 36.24 and 133.18, and the positive samples values were between 68.25 and 133.18 (Table 1).
For studied Counties, information obtained are particularly important as they are the first reported data on Toxoplasma infection in the area.
High prevalence, approaching 100%, obtained from wild boar shoot the alarm on the infestation degree of the environment with oocysts and massive infestation of wild animals (Fig. 1). This should scare us more considering to consumption, quite frequently, of game meat, especially wild boars meat.
The study found the absolute need to best practice animal husbandry and food to reduce the risk of transmission of infection with T. gondii in humans and other animals.
By indirect immunofluorescence, the Czech Republic has a prevalence of 26.2% in wild boars and the Slovak Republic, 8.1% (1, 2). In Spain, the prevalence of Toxoplasma gondii infection in wild boars was 38.4% and in Japan ranged from 5.6% in 1999 to 0% in 2006 (5, 7, 8).
Toxoplasma infection of pigs in Timis County matters both because of neonatal death can occur in pigs, and the possibilities of disease transmission to humans through inadequately cooked meat.
Insufficiently cooked pork meat is an important source for the T. gondii infection transmission to humans. It would be necessary to implement programs for disease control as among animals, from cats and continuing with farm animals to reduce the infestation degree of the environment and thus, economic losses in animal products and in people, especially those engaged in the highest risk category, ie pregnant women and immunosuppressed persons.
CONCLUSIONS ‐Wild boars showed Toxoplasma seroprevalence of 94.23%, with variations between 50 and 100%. ‐Not having sufficient information about examined animals can't refer to the distribution of prevalence by age or gender. ACKNOWLEDGMENTS
This work was supported by CNCSIS, Bd, grant No. 87/2008 obtained by Ionela Hotea and by CNMP, grant PC No. 51‐013/2007.
71
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 1. Geographical distribution of Toxoplasma gondii infection positive wild boars, in
Timis County
Table 1. Prevalence of Toxoplasma gondii infection in wild boars in Timis County
No. No examinated wild boars No. positive samples (%)
The minimum and maximum titres
values
Total prevalence
1. 3 wild boars ‐ Buzias 3 (100%) 124.87‐133.182. 3 wild boars ‐ Brestovat 3 (100%) 112.39‐126.863. 5 wild boars ‐ Surduc 5 (100%) 80.01‐103.264. 4 wild boars ‐ Buzias 4 (100%) 95.06‐99.225. 3 wild boars ‐ Ohaba Lunga 3 (100%) 89.45‐129.756. 4 wild boars ‐ Paniova 2 (50%) 36.24‐98.677. 6 wild boars ‐ Sacosu Mare 5 (83.33%) 31.05‐92.81
8. 5 wild boars ‐ Cheveresu Mare 5 (100%) 101.64‐130.719. 3 wild boars ‐ Racovita 3 (100%) 68.25‐99.4110. 4 wild boars ‐ Secas 4 (100%) 75.68‐121.7211. 4 wild boars ‐ Culina 4 (100%) 96.35‐127.2712. 5 wild boars ‐ Zolt 5 (100%) 92.08‐110.85
13. 3 wild boars ‐ Topolovatu Mare
3 (100%) 120.38‐132.40
Total 52 49 94.23 %
Brestovat 100%
Surduc 100%
Ohaba Lunga 100%
Cheveresu Mare100%
Buzias 100%
Paniova 50%
Sacosu Mare 83.33%
Racovita 100%
Secas 100%
Culina 100%
Zolt 100%
Topolovatu Mare 100%
72
Lucrări Științifice – vol 53 seria Medicină Veterinară
REFERENCES: 1. Antolova D, Reiterova K, Dubinsky P., 2007. Seroprevalence of Toxoplasma gondii in wild
boars (Sus scrofa) in the Slovak Republic. Ann. Agric. Environ. Med., 14, 71‐73. 2. Bartova E., Sedlak K., Literak I., 2006. Prevalence of Toxoplasma gondii and Neospora
caninum antibodies in wild boars in the Czech Republic. Veterinary Parasitology, 142, 150 – 153.
3. Chitimia, Lidia, Cosoroaba, I., Cozma, V., 2007. Toxoplasmoza. Prevenirea transmiterii la om prin alimente de origine alimentara, Rev. Rom. Med. Vet., 3, 11‐30.
4. Darabus, Gh., Oprescu, I., Morariu, S., Mederle, Narcisa, 2006. Parazitologie si boli parazitare, Ed. Mirton, Timisoara.
5. Gauss CB, Dubey JP, Vidal D, Ruiz F, Vicente J, Marco I, Lavin S, Gortazar C, Almería S., 2005. Seroprevalence of Toxoplasma gondii in wild pigs (Sus scrofa) from Spain. Veterinary Parasitology, 131, 151‐156.
6. Hotea Ionela, Darabus Gh., Mederle Narcisa, Ilie M.S., Imre K., Balint A., Indre D., 2009. Prevalenta infectiei cu Toxoplasma gondii la pisici in judetul Arad. Lucrari stiintifice Iasi, 52, 587‐592.
7. Nogami S., Tabata A., Morimoto T., Hayashi Y., 1999. Prevalence of anti‐Toxoplasma gondii antibody in wild boar (Sus scrofa riukiuanus) on Iriomte Island. Japan, Veterinary Research Communications, 23, 211 – 214.
8. Omata, Y, Murata, K., Ito, K., Ishiguro, N., 2005. Antibodies to Toxoplasma gondii in free‐ranging wild boar (Sus scrofa leucomystax) in Shokoku, Japan. Japan. J. of Zoo and Wild. Med., 10, 99‐102.
9. Tenter, A.M., Heckeroth, A.R., Weiss, L.M., 2000. Toxoplasma gondii: from animals to humans, Internat. J. for Paras., 30, 1217‐1258.
73
EPIDEMIOLOGICAL INVESTIGATIONS ON DIGESTIVE PARASITOSIS IN RACING PIGEONS AND THE RISK OF RELEASING PARASITIC
ELEMENTS IN FREE AREAS
Olimpia C. IACOB, B.C. ŞÎŞCĂ Faculty of Veterinary Medicine Iasi
Abstract Investigations were conducted during March 2008 ‐ May 2009 on some lofts of racing pigeons (464 pigeons) from six private property holdings, located in different locations (four in area B and two in area I), in order to study the digestive parasitosis and to reveal the epidemiological role of racing pigeons in dissemination and transmission of parasitic diseases in free areas during training or competition flights. Farms have optimal growth conditions ensuring the comfort of pigeons to achieve maximum results in competitions. Excessive sensitivity of pigeons in stress conditions calls attention from pigeon fanciers to ensure housing conditions, feeding and water consumption, administration of medicinal preparations, sanitary and medical preventive measures, a specialist being required in exceptional cases; sometimes the faulty intervention led to expensive loss by death or by compromising pigeons next flying season. Regular investigations revealed that digestive parasitosis were within 10% of all illnesses. Among the digestive parasitosis that developed were trichomonosis, ascaridiosis in adult birds and intestinal Eimeriosis in squabs confirming the source of invasive elements (Eimeria oocysts, Trichomonas trofozoits, Ascaridia and Capillaria eggs), not only for pigeons from other geographic areas but also for other susceptible birds, given the impressive distances traveled by pigeons during training and racing. In cases of severe episodes of illness in the loft of pigeons, the pigeon fanciers practice the ”stamping out” method thus limiting the diffusibility of the illnesses.
Keywords: racing pigeons, digestive parasites, flights, epidemiological risk
INTRODUCTION
The beauty, gentleness and delicacy of the pigeons and also their sports skills have
definitely captured man. Great interest into the racing pigeons, their movement and sporting events, calls for greater attention from the pigeon fanciers and an increased wariness on the part of veterinary medical personnel (1, 4).
Digestive based parasitosis (Trichomonosis, Eimeriosis, Toxoplasmosis, Echinostomosis, Cestodosis, Ascaridiosis, Capillariasis, Trichostrongyliasis, Tetramerosis, Acuariosis etc..) affects both young and adult pigeons, given the location of many species of parasites from the mouth up to cloaca. Epidemiological surveillance prevents transmission of parasitosis both to the loft of pigeons and to other susceptible birds and not least, the transmission of disease to man (Toxoplasmosis, Psittacosis, Pseudotuberculosis, Salmonellosis, Paramyxovirosis, etc.). (2)
The emergence and evolution of parasitosis in pigeons are conditioned by environmental factors, interrelations between ecosystems, microorganisms and parasites, the interdependence between them, the emergence of new bacterial, viral or parasitic strains. Adult pigeons contracts generally mild forms, asymptomatic, that sometimes pass unnoticed, thus becoming carriers and eliminators of invasive elements transported over long distances in
74
Lucrări Științifice – vol 53 seria Medicină Veterinară
free areas. Squabs and the young pigeons are extremely vulnerable to failure to the antiparasitic and antiinfectous prophylaxic measures and often end in death. (3, 5).
Racing pigeons, through all their qualities, continue to provide services to humanity even in the century of cosmic flights, maintaining their quality of outstanding carrier under certain circumstances. (1, 4)
The aim of the paper Investigations were conducted in order to study the digestive parasitosis in racing
pigeons and to reveal the epidemiological role in the transmission and dissemination of parasitic elements in the free areas and / or their contamination with new invasive elements at their return to the farm after sporting events.
MATERIAL AND METHOD
The epidemiological study was conducted during March 2008 ‐ May 2009, through
investigation of six racing pigeons farms situated in different locations and long distance (four located in city B and 2 located in the city I). Number of pigeons in these farms was of 434 pigeons in peak season, including all age groups (from 10 days to 18 to 20 years) and both sexes, pairs and unpaired. Since pigeons are highly sensitive to stress, access to farms was periodically or only when the owners have announced cases of disease.
The epidemiological investigation recorded: the placement of the farm, the housing spaces, the material used to build shelters, the surface reported to the pigeons density, the division of housing space, the lighting and ventilation level that each shelter gives.
There have been analyzed the epidemiological history regarding the emergence and evolution of diseases in farms of racing pigeons, their incidence, morbidity and mortality, immune status, the presence of a register or record book where is recorded the situation of pairs, spawns date, the hatching, squabs in nests, effectively applied immunoprophylaxis measures, etc.
There have been investigated the administration of food, quantity and content of the diet, how the food is stored (in warehouses or storage), watering system used in farming, water source and frequency of its use, method of manure disposal and discharge frequency, collection and disposal of residues resulting from mechanical cleaning, the conduct of decontamination and the materials used for this purpose in each farm.
If participating in competitions, the investigations recorded the pigeons training mode, the frequency of competitions, transportation to the place of shipment, the vehicle used, mode of shipment and transportation to launch site, food rations and structure. The recovery protocol has also been analyzed for the pigeons returning home after 3‐4 days of flight, period of time they have been exposed to contamination with infectious and parasitic elements.
It has been also investigated the specialized veterinary assistance and the prophylaxia measures adopted, looking at the mode of administration and dosage of medicinal preparations, the time of treatment and results, immunological situation of the loft, mandatory vaccinations (Influenza, Pseudopesta, Paramixovirosis, Salmonellosis etc.). and more. The mode of vaccination, type of vaccine used (fluid/oil, live attenuated / inactivated) type of strain, the date of vaccination and training protocol that preceded the operation has also been investigated.
The results were classified in tables and expressed graphically, and the images were taken with a digital camera.
75
Universitatea de Științe Agricole și Medicină Veterinară Iași
RESULTS AND DISCUSSIONS Monitored farms are organized on pigeon fanciers principles, built and equipped
properly to provide optimum comfort conditions to the lofts of pigeons (80‐100 pigeons each). The dimensions of the shelters are variable and between 4‐12 m long, 2‐4 m wide and 3.2 m high. Some farms have shelters suspended at a height of 2‐3 m above the ground (Fig. 1), others are on the ground, facing south or southwest. The roof is normaly made from asbestos or tiles, and the walls of wood or hardboard. The facade consists of windows, net access door and flap doors for pigeons entering and leaving. Access is through a system of ”needles”, metal rods sliding towards the entrance or exit. In general, the shelters present aviaries in front.
Fig. 1. Farm 1‐ pigeons in aviaries
Inside, the shelters are divided for each age: squabs, young pigeons, for flight,
breeding, ensuring feeding and watering devices, accommodation and recreation or nests (Fig. 2, 3, 4).
Feeding is carried by each pigeon fancier regarding the posibilities and goal, based on a mixture of grain, to varying degrees depending on the period of growth and training, supplemented with vitamins and minerals. Breeding material is domestic or from import: Janssen, Aarden, Wim Muller, van Roy, van der Weggen. Predominant colors are red, scaly and black, dark, genetically dominant. In most farms pigeons have performance results in fond, semifond or marathon competitions. Prevention measures are applied rigorously, since on their outcome depends the participation in competitions. On return from the race pigeons are receiving vitamin‐mineral supplements purchased from specialized companies, antiparasitic treatments and preventive antiinfectous drugs.
76
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 2. Farm 1. Flying pigeons compartment with pigeons in boxes and paired
Fig. 3. Farm 2.Young pigeons compartment
77
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 4. Farm 6. Flying pigeons compartments
The incidence of diseases in racing pigeons from the six farms has been analyzed periodically, revealing the different aspects. Pigeons examination results from January 2008 are listed in Table 1.
Table 1.
The structure of the flock of pigeons and the suspected cases of ilness in January 2008
Farm (F)
Number of adult
pigeons
Number of squabs
Examined
Suspected of ilness
Adults Squabs Adults Squabs 1. 28 0 4 0 0 0
2. 70 0 2 0 0 0
3. 62 0 6 0 0 0
4. 110 4 8 4 0 2
5. 72 0 6 0 0 0
6. 66 0 8 0 0 0
Total 408 4 34 4 0 2
Analyzing the data in Table 1, note that in January, the loft of pigeons in the study
totalize a number of 408 pigeons, of which four were squabs that appeared accidentally in F 4. Clinically examined were 34 adults and four squabs suspected with Trichomonas columbae infestation. Of the four squabs, two were positive infestated with T. columbae (F 4).
78
Lucrări Științifice – vol 53 seria Medicină Veterinară
All specimens examined showed signs of irregularity, mild loss of appetite and the 4 squabs manifested additional symptoms as diarrhea, prostration, and difficulty in swallowing or horiplumation. The dynamics of disease incidence within these six farms in January 2008 is shown in Fig. 5.
Fig. 5. The dynamics of pigeons ilness within the six studied farms in January 2008
Pigeons examination results in April, 2008 are included in Table 2.
Table 2. The structure of the flock of pigeons and the suspected cases of ilness in April 2008
Farm (F)
Number of adult
pigeons
Number of squabs
Examined
Suspected of ilness
Adults Squabs Adults Squabs
1. 28 16 2 6 0 2
2. 70 32 6 12 1 4
3. 60 45 12 16 0 2
4. 104 36 8 4 0 1
5. 72 26 6 12 1 2
6. 62 27 2 8 0 0
Total 396 182 36 58 2 11
Analyzing the data in Table 2, it is observed that in April breeding is already
underway, with a total of 182 offspring, thus totaling 578 actual specimens older than 10 days. Clinically examined were 36 adult pigeons two of them being suspected of disease
and 58 squabs, of which 11 were suspected, totalizing 13 pigeons with altered state. Pigeons had diarrhea, irregularity, mild loss of appetite, the clinical signs being more pronounced in
79
Universitatea de Științe Agricole și Medicină Veterinară Iași
squabs, in addition being found and dull plumage. It is noted that the number of birds affected is higher in F 2 (5 pigeons, about 39% of total), where pigeon fancier started breeding first from all other six fanciers (March 6). The dynamics of disease incidence in pigeons within the six studied farms in April is depicted in Fig. 6.
Fig. 6. The dynamics of pigeons ilness within the six studied farms in April 2008
Pigeons examination results in August 2008 is included in Table 3.
Table 3. The structure of the flock of pigeons and the suspected cases of ilness in August
2008
Farm (F) Number of
adult pigeons
Number of squabs
Examined
Suspected of ilness
Adults Squabs Adults Squabs
1. 18 29 4 12 1 2
2. 52 46 6 16 1 4
3. 48 34 12 10 2 3
4. 68 42 10 8 2 5
5. 64 32 9 6 1 2
6. 52 34 8 5 0 1
Total 302 217 49 57 7 17
In Table 3 it can be observed the decrease in the number of adults because the
competion season is in full swing, and the increase in the number of young pigeons seeking to balance the loft. There were clinically examined 106 specimens from the age of 10 days and
80
Lucrări Științifice – vol 53 seria Medicină Veterinară
were identified as suspicious of disease 24 pigeons. Symptoms were typical for nematodosis and intestinal trichomonosis characterized by digestive syndrome, weakness, difficulty in swallowing, the presence of fibrinous deposits in the mouth, prostration, left wing. The dynamics of disease incidence in pigeons within the six studied farms in April is depicted in Fig. 7.
Fig. 7. The dynamics of pigeons ilness within the six studied farms in August 2008 Pigeons examination results in December is included in Table 4.
Table 4. The structure of the flock of pigeons and the suspected cases of ilness in December
2008
Farm (F)
Number of adult
pigeons
Number of squabs
Examined
Suspected of ilness
Adults Squabs Adults Squabs
1. 22 16 6 6 0 0
2. 54 22 10 8 1 2
3. 50 20 16 12 0 1
4. 54 18 12 8 0 0
5. 60 22 18 6 1 0
6. 48 24 9 8 0 2
Total 288 122 71 48 2 5
In Table 4 is observed that the number of adult birds decreased compared with the
summer season: in August, adult birds were sorted through competitive stages (marathon, national contests), through sales, or losses and youth has also been sorted through training flights and squabs trials.
81
Universitatea de Științe Agricole și Medicină Veterinară Iași
There have been 119 pigeons clinically examined of which five pigeons had digestive disorders. The symptoms presented by the sick pigeons were similar to those described above, specifying that in this case they had a common character regardless of pigeons age. Reduced incidence of cases of disease can be explained because there were applied prevention measures in farms in September‐October and the youth through growth have strengthened their immune status, the lofts reaching an immunological uniformity.
The dynamics of disease incidence in pigeons in December 2008 is depicted in Fig. 8.
Fig. 8. The dynamics of pigeons ilness within the six studied farms in December 2008
Examination result for the flocks of pigeons in March 2009 is contained in Table 5.
Table 5. The structure of the flock of pigeons and the suspected cases of ilness in March
2009
Farm (F)
Number of adult pigeons
Number of squabs
Examined
Suspected of ilness
Adults Squabs Adults Squabs 1. 38 0 4 0 0 0
2. 74 0 2 0 0 0
3. 72 0 6 0 1 0
4. 70 0 2 0 0 0
5. 94 0 7 0 0 0
6. 69 12 10 8 3 2
TOTAL 417 12 35 8 4 2
In Table 5 can be observed that in March 2009 pigeons examination included a
reduced number of pigeons, 35 adults four of them being suspected of disease and eight squabs in which two suspected. During this time most farms applied spring prophylactic
82
Lucrări Științifice – vol 53 seria Medicină Veterinară
measures with positive results on lofts of pigeons and reduce cases of disease. The dynamics of disease in lofts of pigeons in March 2009 is depicted in Fig. 9.
Fig. 9. The dynamics of pigeons ilness within the six studied farms in March 2009
Following further demands expressed by other pigeon fanciers, was conducted clinical examination of pigeons with impaired health who presented polymorphic symptoms. Note that in June and September 2008 were examined 20 cases, in April 2009, 34 cases and in May 2009, 12 cases (Table 6).
Table 6. The incidence of the supplementery demands of examination for the pigeons that expressed
impaired health from the six studied farms, March 2008 – May
Pigeons Farm
Examined pigeons (March 2008‐May 2009)
Mar May Jun Jul Sep Oct Nov Jan Feb Apr May
1. 2 0 0 0 6 0 0 0 5 0 5
2. 0 4 0 0 0 0 11 0 0 9 0
3. 0 0 8 0 14 0 0 0 0 0 0
4. 0 0 12 0 0 6 0 0 0 0 7
5. 0 6 0 0 9 0 0 0 0 13 0
6. 4 0 0 0 0 0 0 0 0 12 0
TOTAL 6 10 20 0 20 6 11 0 5 34 12
In Table 6 it appears that following the additional claims arised from the occurrence of morbid states, were clinically examined a number of 124 racing pigeons of all ages and both sexes stressing that regular examinations were not sufficient. The dynamics of disease in pigeons with polymorphic symptoms indicated by additional requests in 2008‐2009 is shown in Fig. 10.
83
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 10. The dynamics of the supplementary examinations in pigeons from the six studied farms in March 2008 – May 2009
The incidence of digestive parasitic diseases detected in pigeons that were supplemetary examined during March 2008‐May 2009 is contained in Table 7.
Table 7. The incidence of the digestive parasitosis suspected cases after the supplementary
examinations of pigeons in March 2008 – May 2009
Pigeons Farm
Pigeons suspected of digestive parasitosis
Mar May Jun Jul Sep Oct Nov Jan Feb Apr May
1. 0 0 0 0 1 0 0 0 1 0 1 2. 0 0 0 0 0 0 0 0 0 0 0 3. 0 0 1 0 2 0 0 0 0 0 0 4. 0 0 2 0 0 0 0 0 0 0 3 5. 0 0 0 0 0 0 0 0 0 2 0 6. 2 0 0 0 0 0 0 0 0 0 0
TOTAL 2 0 3 0 3 0 0 0 1 2 4
In Table 7 is observed the incidence of disease cases in pigeons examined following additional requests and, based on the clinical picture were suspected of an ongoing digestive parasitosis, the ratio beetween the number of examined pigeons (124) and the number of suspects (15) being relatively low. The dynamics of digestive parasitosis suspected in the lofts of pigeons examined following additional requests is depicted in Fig. 11
84
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 11. The dynamics of the digestive diseases incidence in pigeons from the six studied
farms in March 2008 – May 2009
The monitoring of the six farms of racing pigeons has been regularly made and added the supplementary investigations for defining the intensivity and extensivity of the invasive elements and their transmission to free areas or contamination of pigeons during training and competitions with new parasitic elements and their dissemination at the return to nest. The medical history reveals that four of the six pigeon fanciers use the”stamping‐out'' method in case of severe disease, removing the specimens from the farm or isolating them in quarantine boxes and applying appropriate treatment measures in order to reduce or block the horizontal transmission of disease. Housing spaces for ground holdings (and those suspended uncleaned and unsanitized), are a spore‐starting favorable environment for the oocysts of Eimeria, and preservation of eggs of Ascaridia, and Capillaria eliminated by adult carrier pigeons and the infestation of the squabs or young pigeons. Any parasitic aggression exerted on the digestive tube has direct consequences for the harmonious development of pigeons, flight capacity and also reduce sports performance. Permanent epidemiological surveillance represents the basis to prevent the occurrence of morbid states of parasitic, infectious, nutritional origin in lofts of pigeons and to limit the risk of transmission of zoonoses in humans.
CONCLUSIONS
Epidemiological investigations were conducted during January 2008 ‐ May 2009 on
some lofts of racing pigeons from six private farms to highlight the presence of invasive parasitic elements and the risk of their dissemination during flight in free areas.
Of all cases studied (464 pigeons), 80% were suspected as bacterial or viral diseases, 10% were suspected as digestive parasitosis (46 pigeons) and 10% as other disorders.
The clinical expression of the morbid states was reduced during January‐March 2008, then from April until August, there was an upward curve of disease which peaked in June.
85
Universitatea de Științe Agricole și Medicină Veterinară Iași
In the monitored farms the flight was performed and the pigeons were selected based on their sports performance and not their phenotypic characters; the studies have shown that following sports season, several pigeons are lost or suffering from the insidious nature diseases that determine a decrease in resistance to stress and sustained exercise.
It was noted the important role of hygiene, proper nutrition, preventive measures and compliance with density, but above all, vigilance and knowledge of the most common parasitic diseases to intervene in time and to minimize the future economic and emotional losses.
During training and sports competitions pigeons fly huge distances (thousands of km) increasing the risk of disseminating invasive elements (and not only) in areas free of infestation followed by the infestation of other lofts of pigeons or responsive gallinaceae and also their contamination when travelling endemic areas and infestation of the loft at their return.
Pigeons are meant to fly free and for racing pigeons to return to their nest regardless of where they are released, requiring constant epidemiological surveillance and a real collaboration between fanciers and veterinary service. BIBLIOGRAPHY
1. Bilius, M., 2000 ‐ ,,Paranormal sau intuiție la porumbelul călător’’, Revista Voiajorul. 2. Iacob, Olimpia, 2002 – Parazitologie şi clinica bolilor parazitare‐ Protozooze. Ed. “Ion Ionescu de la Brad” Iaşi pag. 66‐69; 102; 135‐143. 3. Iacob Olimpia, 2006‐ Parazitologie şi clinica bolilor parazitare la animale –Helmintoze. Ed. “Ion Ionescu de la Brad” Iaşi pag. ; 344‐ 347; 396‐398; 402‐407 4. Iftode, Ghe., Georgiana Iftode, Cristina Iftode, Mirela Iftode, 2006 – Porumbeii de agrement şi sport din România. Ed. Lidana, Suceava 5. Severeanu, I., F. I., Ivana, 1991 ‐ ,,Bolile porumbeilor’’ Ed. Ceres, Bucureşti pag.177‐206
86
PRELIMINARY DATA CONCERNING OPTIMIZATION
OF A PCR‐BASED METHOD FOR MOLECULAR DETECTION OF TICK‐BORNE PATHOGENS
Mariana IONITA 1, D.K. HOWE2, I.L. MITREA1, B. STEVENSON3, Michelle YEARGAN2
1UASVM Bucharest, Faculty of Veterinary Medicine, Splaiul Independentei 105, sector 5, 050097, Bucharest, Romania, ionitamvet@yahoo.com
2Department of Veterinary Science, Gluck Equine Research Center, University of Kentucky, Lexington, KY 40546‐0099, USA; 3Department of Microbiology, Immunology, and Molecular
Genetics, College of Medicine, University of Kentucky, Lexington, KY 40536‐0298, USA
Tick‐borne zoonotic infections are among the most diffuse vector borne diseases. Approximately 10% of the currently known 867 tick species act as vectors of a broad range of pathogens (protozoa, rickettsia, spirochaetes and viruses) of domestic animals and humans, and a significant number of these pathogens are agents of emerging infectious diseases. One of the first step for tick‐borne risk assessment is the detection of these pathogens in their vectors. PCR amplification of pathogen DNA using species‐specific primers is now the standard for pathogen detection in ticks. In this paper are presented some preliminary data of our trials on optimizing the general and particular conditions of a PCR‐based RLB assay for molecular detection of Borrelia burgdorferi – the agent of Lyme disease, one of the most important tick‐borne zoonotic disease. We used the 23S‐5S rRNA spacer region of B. burgdorferi sensu lato as the target for PCR and determined the genomic group of B. burgdorferi sensu stricto (B31 strain) by hybridization of the PCR product to four genomic‐specific oligonucleotide probes immobilized on a membrane. The PCR was shown to be species specific; in RLB assay the anticipated genomic group ‐ B. burgdorferi sensu stricto was identified in all positive samples. No cross hybridization with other genomic group were registered in RLB assay. The genomic group was confirmed also by DNA sequencing, and in consequences the method was validated.
Key words: ticks, pathogens, detection, Borrelia burgdorferi, PCR, RLB hybridization
Vector‐borne diseases are currently considered a major health risk, not only in tropical and subtropical regions, but in temperate regions as well, where climate change could create conditions suitable for outbreaks of a such diseases. Predicting the effects of global warming on health requires an examination of the current incidence and distribution of major vector‐borne diseases. Ticks are considered, after mosquitoes, the most important vectors for infectious diseases worldwide. Ticks transmit a greater variety of pathogenic microorganisms (protozoa, rickkettsiae, spirochaetes and viruses) than any other arthropod vector group, and a significant number of these pathogens are agents of emerging infectious diseases (Jongegan and Uilenberg, 2004).
Tick‐borne zoonotic infections are among the most diffuse vector borne diseases (Sambri et al., 2004). Approximately 10% of the currently known 867 tick species act as vectors of a broad range of pathogens of domestic animals and humans (Jongejan and Uilenberg, 2004), which cause diseases such as anaplasmosis, babesiosis, ehrlichiosis, Lyme borreliosis, and rickettsiosis (Estrada‐Pena and Jongegan, 1999). Lyme borreliosis is the most significant vector‐borne disease in Europe and the United States. One of the first step for tick‐borne risk assessment is the detection of these pathogens in their vectors. PCR amplification of pathogen
87
Lucrări Științifice – vol 53 seria Medicină Veterinară DNA using species‐specific primers is now the standard for pathogen detection in ticks (Parola and Raoult, 2001; Sparagano et al., 1999).
Tick‐borne pathogens (protozoa, rickettsia or viruses) can co‐exist in the same tick vector or be carried by different tick species, and it is difficult to identify a pathogen in carrier animals or ticks which are carrying low level of infection. In this situation, molecular tools, particularly amplification of specific markers using the polymerase chain reaction (PCR) have revolutionized detection and identification of pathogenic organisms (Sparagano et al., 1999).
Although many useful species‐specific PCR assays have been developed to detect a particular tick‐borne pathogen, however, PCR assays can be time‐consuming, labor‐intensive and expensive, particularly when testing for multiple pathogens in a large number of samples. For this purpose, it is recommended the use of a test where it is possible to simultaneously detect and differentiate all protozoan and ehrlichial parasites that could possibly be present in a vector ticks or in the blood of an infected host (Sparagano et al., 1999). Reverse line blot (RLB) hybridization, where multiples samples can be analyzed against multiple probes to enable simultaneous detection, fulfils these criteria.
In this paper we presented some preliminary data of the trials on optimizing the general and particular conditions of the PCR‐based RLB assay for molecular detection of some tick‐borne pathogens, such as Borrelia burgdorferi – the agent of Lyme disease. Borrelia burgdorferi sensu lato, the causative agent of the zoonosis Lyme borreliosis (LB), is transmitted by ticks of the genus Ixodes (Burgdorfer et al., 1982). The infection may affect the nervous system, cause arthritis, or result in a chronic cutaneous manifestation, acrodermatitis chronica athrophicans (Steere, 1989). B. brugdorferi sensu lato has been divided into three groups on the basis of DNA relatedness: B. burgdorferi sensu stricto, B. garinii, and B. afzelii (Baranton et al., 1992, Canica et al., 1993).
In the study described here, we used the spacer region between the 5S‐23S rRNA genes (rDNA) of Borrelia burgdorferi sensu lato as the target for PCR. The 23S and 5S rRNA genes are tandemly duplicated in the order 23s‐5S‐23S‐5S in B. burgdorferi sensu lato, and this arrangement has not been found in other members of the genus Borrelia or other eubacteria (Schwartz et al., 1992). In the second step, we determined the genomic group of B. burgdorferi sensu stricto (B31 strain) by hybridization of the PCR product to four genomic‐specific oligonucleotide probes immobilized on a membrane, testing different conditions, in order to optimize the method for further molecular studies. MATERIALS AND METHODS
Ticks and bacterial strains. Ixodes ricinus ticks were collected from natural infested
cattle from some regions in North‐East of Romania. Immediately after collection, the ticks were immersed in 70% ethanol and stored.
The genomic group of Borrelia burgdorferi sensu stricto ‐ B31 strain was used for testing the specificity of PCR and RLB hybridization, in order to optimize the particular conditions for the methods.
Preparation of DNA extracts from ticks. Ticks were processed as described Schouls et al. (1999). Briefly, the ticks were taken from the 70% ethanol solution, air dried, and boiled for 20 min in 100 μl of 0.7 M ammonium hydroxide to free the DNA. After cooling, the vial with the lysate was left open for 10 min at 90°C to evaporate the ammonia. The tick lysate either was used directly for PCR or was stored at ‐20°C until use.
PCR amplification. The polymerase chain reaction (PCR) amplification was carried out in a 25‐μl reaction volumes. For the amplification of Borrelia burgdorferi sensu lato DNA, each
88
Universitatea de Științe Agricole și Medicină Veterinară Iași reaction mixture contained the primers 23SN2 and 5SCB (Table 1), and 5μl aliquots of the B. burgdorferi s.s. DNA and tick extracts. To minimize nonspecific amplification a touchdown PCR program was used: 3 min at 94°C, two cycles of 20 s at 94°C, 30 s at 67°C, and 30 s at 72°C, and then two cycles with conditions identical to the previous cycles but with an annealing temperature of 65°C. During subsequent two cycles sets the annealing temperature was lowered by 2°C until it reached 57°C. Then, an additional 40 cycles each consisting of 20 s at 94°C, 30 s at 57°C, and 20 s at 72°C, followed the touchdown program, were performed. The PCR was ended by an extra incubation for 7 min at 72°C.
Reverse Line Blot Hybridization. The reverse line blotting technique was performed as described by Schouls et al. (1999). For species identification, Borrelia PCR product were hybridized with probes for B. burgdorferi sensu lato, B. burgdorferi sensu stricto, B. afzelii, B. garinii.
DNA sequencing. The PCR products from samples with positive signal in RLB assay were used for DNA sequencing in order to confirm the genotype of Borrelia burgdorferi and implicit for validation of methods.
RESULTS AND DISCUSSIONS
For determining the specificity of PCR were tested range of B. burgdorferi sensu
stricto (B 31 strain) DNA concentrations: two samples diluted in water, one pooled with tick lysate. The last one samples was added in order to check the potential presence of tick inhibitors for PCR amplification. In the PCR were included also three different samples with tick lysates from Ixodes ricinus, which were not positive in previously PCRs.
89
Table 1
Olig
onucleotide prim
ers an
d prob
es used in PCR
and
hybridization
assay
Oligon
ucleo‐
tide
nam
e Oligon
ucleotide sequ
ence
Target organ
ism
Target gen
eNucleotid
position
Re
ference
Prim
er
5SCB
23SN
2 5’biotin‐GAGAGTA
GGTTATTGCC
AGGG
ACC
ATA
GACT
CTTA
TTACT
TTGACC
A Bo
rrelia burgd
orferi sensu lato
Borrelia burgd
orferi sensu lato
23S‐5S spacer
23S‐5S spacer
243‐263
469‐444
Rijpkema
et al, 1995
Prob
es
SL
SS
GA
AF
5’‐amino‐CT
TTGACC
ATA
TTTTTA
TCTTCC
A
5’‐amino‐AACA
CCAATA
TTTA
AAAAACA
TAA
5’‐amino‐AACA
TGAACA
TCTA
AAAACA
TAAA
5’‐amino‐AACA
TTTA
AAAAATA
AATTCA
AGG
Borrelia burgd
orferi sensu lato
Borrelia
burgdo
rferi
sensu
stricto
B. garinii
B. afzelii
23S‐5S spacer
23S‐5S spacer
23S‐5S spacer
23S‐5S spacer
453‐430
322‐299
322‐298
305‐278
Rijpkema
et al, 1995
Lucrări Științifice – vol 53 seria Medicină Veterinară
90
Universitatea de Științe Agricole și Medicină Veterinară Iași
From each PCR reactions, 5 μl were subjected to electrophoresis on ethidium bromide‐stained 1% agarose gel and visualized under UV transillumination (fig. 1).
In all samples with B. burgdorferi DNA (B 31 strain non‐diluted, diluted in water) the intergenic 23S‐5S spacer gene was amplified, obtaining a visible band of 226 bp (Fig. 1). No any differences of PCR amplification for diluted sample were registered. Also, the sample with B. burgdorferi DNA pooled with tick lysate was amplified in the PCR. This finding, emphasizes that there were not tick inhibitors which could affect the amplification reactions in the PCR.
The three tick lysate samples were not amplified by PCR the B. burgdorferi intergenic 23S‐5S spacer gene.
Fig. 1. Amplificarea specifică (PCR) a spațiatorului intergenic 23S‐5S a rDNA (226 bp) ‐ Borrelia burgdorferi: 1,2,3‐tick lysate; MW‐molecular weight marker; 4‐B. burgdorferi DNA non‐diluted; 5‐B. burgdorferi DNA diluted in water; 6‐B. burgdorferi pooled with tick lysate; 7‐
negative control (water)
Only the intergenic 23S‐5S amplicons were subjected to the RLB assay. For optimizing the conditions for RLB assay, different oligonucleotidic probe concentrations were used, ranging from 10 pmol to 800 pmol (Table 2). In the RLB hybridization, a negative control (water), was included, too. Hybridization of PCR products to species‐specific probes was revealed by chemiluminescence using Super‐Signal substrate (Pierce, Rockford, IL), and images were documented with a FluorChem 8800 imaging system (Alpha Innotech, San Leandro, CA).
MW 4 5 6 7 81 2 3
226 bp
91
Lucrări Științifice – vol 53 seria Medicină Veterinară
Table 2 Oligoprobe final concentrations tested in the RLB assay
Oligoprobes Final concentration
(c‐pmol) References
B. burgdorferi SL (sensu lato) 100 Schouls et al., 1999B. afzelii (AF) 800 Schouls et al., 1999B. garinii (GA) 800 Schouls et al., 1999B. burgdorferi SS1 (sensu stricto) 100 Schouls et al., 1999B. burgdorferi SS2 (sensu stricto) 50 Schouls et al., 1999B. burgdorferi SS3 (sensu stricto) 25 Schouls et al., 1999B. burgdorferi SS4 (sensu stricto) 10 Schouls et al., 1999
Fig. 2. Reverse line blot hybridization assay analyses for the detection and identification of B.
burgdorferi. The oligonucleotide probes are attached to the membrane in the horizontal direction. and the PCR samples applied perpendicularly in the vertical direction. The PCR amplicons derived from: 1‐B. burgdorferi non‐diluted DNA; 2‐B. burgdorferi DNA diluted in
water; 3‐negative control (water); 4‐6B. burgdorferi pooled with tick lysate
B. burgdorferi SL
B. burgdorferi SS3 B. burgdorferi SS4
B. burgdorferi SS2 B. burgdorferi SS1
B. garinii
B. afzelii
OLI
GO
NU
CLE
OTI
DE
PR
OB
ES
PCR Products
1 2 3 4 5 6
92
Universitatea de Științe Agricole și Medicină Veterinară Iași
The PCR was shown to be species specific, and in RLB assay the anticipated genomic group ‐B. burgdorferi sensu stricto was identified in all positive samples.
The optimal concentration of the B. burgdorferi SS oligoprobe was 10 pmol. No cross hybridization with other genomic group were registered in RLB assay.
Three of the PCR amplicons which have shown positive hybridization in the RLB assay were subjected to DNA sequence analysis, in order to confirm the genomic group, and to validate the method. Sequences were determined in both directions (using the same primers individually as for the PCR). Sequences were subjected to National Center for Biotechnology Information (NCBI) BLAST analysis for the homology. NCBI BLAST analysis revealed 99% homology with Borrelia burgdorferi (strain B31) sensu stricto internal transcribed spacer DNA sequences available in Genbank (accession numbers: L30127.1 GI:508388) (fig. 3).
Therefore, results of the trials described in this study, confirmed the genomic group, and validated the optimal conditions of the PCR‐based RLB hybridization method, for further studies for molecular detection of tick‐borne pathogens in Romania.
RLB was originally developed for the identification of Streptococci serotypes (Kaufhold et al., 1994). The assay has been used also for molecular identification of some parasites such as equine small strongyle species (Traversa et al., 2007, Cernaska et al., 2009, Ionita et al., 2010).
The first application of RLB for the detection and differentiation of pathogens in ticks was developed for Borrelia spirochetes (Rijpkema, 1995), for simultaneously identify the genomic groups of B. burgdorferi sensu lato in ticks collected in the field. The results showed that 10 to 35% of the Ixodes ricinus ticks from The Netherlands were infected with B. burgdorferi genospecies. Subsequently, RLB was combined with Ehrilichia spp. (Schouls et al., 1999), confirming the previously findings; on the other hand, it showed, also a high rate of infection with Ehrlichia species (45%), and coinfection with Ehrlichia and two genospecies of B. burgdorferi
RLB was then successfully applied for the detection and differentiation of all known Theileria and Babesia species (Gubbels et al., 1999), for the characterization of Babesia divergens in humans (Centeno‐Lima et al., 2003), and novel Theileria and Babesia species were discovered through the application of RLB (Nijhov et al, 2003). Furthermore, RLB was used for detection and differentiation of many Babesia and Theileria spp. occurring in small ruminants (Schnittger et al., 2004). PCR and RLB were used, also to detect and identify B. burgdorferi sensu lato, Anaplasma and Ehrlichia species, and spotted fever group rickettsiae in ticks from Southeastern Europe (Christova et al., 2003). Prevalence data for pathogens in ticks can be used to assess the risk of tick‐borne diseases for public health.
In conclusion, RLB is a versatile diagnostic tool, which sensitively and simultaneously detects and differentiates pathogens in ticks, blood or tissue. RLB combine PCR amplification followed by a hybridization step, resulting in sensitivity up to 100 fold or higher than PCR only.
CONCLUSIONS
1. The optimal conditions of a PCR‐based RLB assay for molecular detection of Borrelia
burgdorferi – the agent of Lyme disease, one of the most important tick‐borne zoonotic disease, were established.
2. Amplification and hybridization of the 23S‐5SrDNA intergenic spacer region provide an accurate and rapid method of determining the presence of the genomic groups of B. burgdorferi sensu lato.
93
Lucrări Științifice – vol 53 seria Medicină Veterinară
3. The PCR was shown to be species specific; in RLB assay the anticipated genomic group ‐B. burgdorferi sensu stricto was identified in all positive samples. No cross hybridization with other genomic group were registered in RLB assay.
4. The genomic group was confirmed by DNA sequencing; the optimal conditions for the PCR‐based RLB hybridization method were validated for further studies for molecular detection of tick‐borne pathogens in Romania.
ACKNOWLEDGEMENT
This work was supported by CNCSIS – UEFISCSU, project number PNII – IDEI code
729/2007, director Mariana Ionita, Lecturer, PhD, DVM.
REFERENCES
1. Baranton G, Postic D, Saint Girons I, Boerlin P, Piffaretti JC, Assous M, Grimont PA., 1992. Delineation of Borrelia burgdorferi sensu stricto, Borrelia garinii sp. nov., and group VS461 associated with Lyme borreliosis. Int J Syst Bacteriol.;42(3):378‐83.
2. Burgdorfer W, Barbour AG, Hayes SF, Benach JL, Grunwaldt E, Davis JP., 1982. Lyme disease‐a tick‐borne spirochetosis?. Science. 18;216(4552):1317‐9.
3. Canica M.M., Nato F., du Merle L., Mazie J.C., Baranton G., Postic D., 1993. Monoclonal antibodies for identification of Borrelia afzelii sp. nov. associated with late cutaneous manifestations of Lyme borreliosis. Scand J Infect Dis.;25(4):441‐8.
4. Centeno‐Lima S, do Rosário V, Parreira R, Maia AJ, Freudenthal AM, Nijhof AM, Jongejan F., 2003. A fatal case of human babesiosis in Portugal: molecular and phylogenetic analysis. Trop Med Int Health.;8(8):760‐4.
5. Cernaska, D., Paoletti, B., Kral’ova‐Hromadova, I., Iorio, R., Cudekova, P., Milillo, P., Traversa, D., 2009. Application of a reverse line blot hybridisation assay for the species‐specific identification of cyathostomins (Nematoda, Strongylida) from benzimidazole‐treated horses in the Slovak Republic. Vet. Parasitol. 160, 171–174.
6. Christova I, Van De Pol J, Yazar S, Velo E, Schouls L., 2003. Identification of Borrelia burgdorferi sensu lato, Anaplasma and Ehrlichia species, and spotted fever group Rickettsiae in ticks from Southeastern Europe. Eur J Clin Microbiol Infect Dis.;22(9):535‐42
7. Estrada‐Pena A., Jongejan F., 1999. Ticks feeding on humans: a review of records on human‐biting Ixodoidea with special reference to pathogen transmission. Exp Appl Acarol.;23(9):685‐715.
8. Estrada‐Pena A., 2009. Tick‐borne pathogens, transmission rates and climate change. Front Biosci., 1;14:2674‐87
9. Gubbels JM, de Vos AP, van der Weide M, Viseras J, Schouls LM, de Vries E, Jongejan F., 1999. Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. J Clin Microbiol.; 37(6):1782‐9.
10. Ionita M, Howe DK, Lyons ET, Tolliver SC, Kaplan RM, Mitrea IL, Yeargan M., 2010. Use of a reverse line blot assay to survey small strongyle (Strongylida: Cyathostominae) populations in horses before and after treatment with ivermectin. Vet Parasitol.;168(3‐4):332‐7
11. Jongejan F, Uilenberg G., 2004. The global importance of ticks. Parasitology. 2004;129 Suppl:S3‐14
94
Universitatea de Științe Agricole și Medicină Veterinară Iași 12. Kaufhold A., Podbielski A., Baumgarten G., Blokpoel M., Top J., Schouls L., 1994. Rapid
typing of group A streptococci by the use of DNA amplification and non‐radioactive allele‐specific oligonucleotide probes. FEMS Microbiol letters; 119(1‐2):19‐25
13. Nijhof A.M., Penzhorn B.L., Lynen G., Mollel J.O., Morkel P., Bekker C.P., Jongejan F., 2003. Babesia bicornis sp. nov. and Theileria bicornis sp. nov.: tick‐borne parasites associated with mortality in the black rhinoceros (Diceros bicornis). J. Clin Microbiol, 41(5):2249‐54
14. Parola P, Raoult D., 2001. Tick‐borne bacterial diseases emerging in Europe. Clin Microbiol Infect.; 7(2):80‐3. Review.
15. Rijpkema S.G., Molenboer M.J., Schouls L.M., Jongejan F., Schellekens J.F., 1995. Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic spacer region between 5S and 23S rRNA genes. J. Clin Microbiol, 33(12):3091‐5
16. Schnittger L, Yin H, Qi B, Gubbels MJ, Beyer D, Niemann S, Jongejan F, Ahmed JS., 2004. Simultaneous detection and differentiation of Theileria and Babesia parasites infecting small ruminants by reverse line blotting. Parasitol Res.; 92(3):189‐96
17. Schouls L.M., Van De Pol I., Rijpkema S.G., Schot C.S., 1999. Detection and identification of Ehrlichia, Borrelia burgdorferi sensu lato, and Bartonella species in Dutch Ixodes ricinus ticks. J Clin Microbiol., 37(7):2215‐22
18. Schwartz JJ, Gazumyan A, Schwartz I., 1992. rRNA gene organization in the Lyme disease spirochete, Borrelia burgdorferi. J Bacteriol. ; 174(11):3757‐65.
19. Sparagano OA, Allsopp MT, Mank RA, Rijpkema SG, Figueroa JV, Jongejan F., 1999. Molecular detection of pathogen DNA in ticks (Acari: Ixodidae): a review. Exp Appl Acarol.; 23(12):929‐60.
20. Steere AC., 1989., Lyme disease. N Engl J Med.; 321(9):586‐96. 21. Traversa, D., Iorio, R., Klei, T.R., Kharchenko, V.A., Gawor, J., Otranto, D., Sparagano, O.A.,
2007. New method for simultaneous species‐specific identification of equine strongyles (Nematoda, Strongylida) by reverse line blot hybridization. J. Clin. Microbiol. 45, 2937–2942.
95
PROPOFOL ANAESTHESIA IN DONKEYS IN COMBINATION
WITH CHLORAL HYDRATE
Ismail, S.F ; Abd Al‐Galil, A.S.A and Gehan, B.A.Youssef Dept. of Surgery, Anaesthesiology and Radiology, Faculty of Veterinary Medicine
Benha University.Egypt
Abstract The anesthesia characterized by bad quality induction with strong nervous manifestation after chloral hydrate injection. Nearly all body reflexes disappeared after propofol infusion. . Complete analgesia and sedation was achieved at 4 minutes after injection where the animals showed no responses to any painful stimuli. The heart rate in this group showed gradual increase while the respiratory rate and body temperature were showed significant decrease. The recovery of the animals characterized by both of the pedal and anal reflexes appeared at 39 minutes after propofol injection .Complete recovery of the animals occurred at 95 minutes with tinny smooth recovery without any signs of nervous manifestation
INTRODUCTION
Propofol is an alkyl phenol derivatives ( 2, 6 di‐iso‐propyl‐phenol). Only slightly
soluble in water and commercially present as an aqueous emulsion containing propofol ( 10mg / ml ), glycerol (100mg/ml), soya bean oil ( 22.5 mg/ml), egg lecithin (12mg/ml) and sodium hydroxide to adjust PH. (Branson and Gross, 1994). Propofol is non barbiturate and relatively non cumulative intravenous anesthetic agent with rapid onset and recovery. It produce smooth induction with possibility of maintenance by intermittent injection ( Muir et al.,2007) Its effects are similar to that of Sodium Pentothal. It provides no analgesia. Yet in some studies, when patients receive propofol compared to inhalation agents for anesthesia, post‐operative pain is less after propofol. Propofol is a potent hypnotic currently formulated as oil in water emulsion. Propofol is a short acting, rapidly metabolized intravenous agent characterized in man by virtual lack of any cumulative effect and by rapid recovery after its administration in a bolus dose or by continuous infusion (Branson and Gross, 1994) Propofol is highly protein bound in vivo and is metabolized by conjugation in the liver. Its rate of clearance exceeds hepatic blood flow, suggesting an extra‐hepatic site of elimination as well as It has several mechanisms of action, (Vanlersberghe and Camu ,2008) both through potentiation of GABA‐A receptor activity, thereby slowing the channel closing time, ( Krasowski, Hong , Hopfinger and Harrison ,2002) and also acting as a sodium channel blocker (Haeseler and Leuwer ,2003) ( Haeseler , Karst , Foadi , Gudehus , Roeder , Hecker , Dengler and Leuwer, 2008) Recent research has also suggested the endocannabinoid system may contribute significantly to propofol's anesthetic action and to its unique properties.( Fowler, 2004) Propofol is a short acting hypnotic unrelated to other general anesthetic agents. Propofol is provided in sterile glass ampoule contains no preservatives; there fore the formulation will support microbial growth and end toxin production (Arduino, Bland and Allister, 1991). Those
96
Lucrări Științifice – vol 53 seria Medicină Veterinară
authors added that, because of the microbial growth and the risk of infection and sepsis any unused propofol should be discarded at the end of the anesthetic procedure. Propofol is oil at room temperature and insoluble aqueous solution. The concentration of propofol is 10% each 1ml containing l0 mg of the active principle. Hui‐Chn lin, Ram and Tom (1997). Chloral hydrate presented as colorless translucent crystals and has penetrating odor. It metabolized by liver into (tri‐chloro‐ethyl alcohol), which in a less potent hypnotic. Chloral hydrate is a good hypnotic but a poor anesthetic and the amount needed to produce anesthesia approach the minimal lethal dose (Reid , Nolan and Welsh (1993) . El‐Sayad (2006), stated that the injection of chloral hydrate in donkeys followed by propofol infusion lead to rapid induction of anesthesia. also added that chloral hydrate followed by propofol induce long time anesthesia and smooth recovery.
MATERIALS AND METHODS
The present study was carried out on 20 donkeys. Collected from the suburban of
kalyobia governorates were used as experimental model .The animals were apparently healthy and their ages and body weights were ranged from 3‐4 years and 120‐150 kg respectively. These animals were collected to investigate the pilot efficacies of propofol alone as well as propofol combination with other anesthetic drugs, according to their physiological, hematological, and neuromuscular effects.
All animals were fasted for about 12 hours and freely given water before being investigated. These investigations were classified into two main parts Before each injection, the jugular vien was cannulated on disinfected clipped skin, the weight of the animal was estimated and the dose of each anesthetic drug was calculated. The clinical signs of the anesthetic regimen including: assessments of its analgesic effect, duration of its action as well as the time of its recovery were recorded. The effect of the regimen on the heart and respiratory rates as well as the body temperature were also measured and tabulated. They were recorded before each injection (0.0 time) and at 5, 10, 20, 30, 60, 120, 180 minutes after injection.
The anesthesia of each regimen was maintained for 30 minutes and the animals were put under observation recording the physiological and the clinical changes until the animals become in the sternal and then in the standing position. A catheter was inserted in the other jugular vein for blood sampling. The blood samples were obtained before injection of each regimen (0.0 time) and at 15, 30, 60 minutes and at 24 hours for the estimation of blood picture, as well as for liver and kidney function tests.
The animals were injected slowly with 10% chloral hydrate solution in a dose of 5 mg/ 50 kg body weight then the anesthesia was maintained by intravenous infusion of 0.2mg / kg/minute propofol diluted in 5 % dextrose in a ratio of 1:4 respectively.
RESULTS The anesthesia characterized by bad quality induction, all animals of this group
showed strong nervous manifestation after chloral hydrate injection (5 mg/ 50 kg body weight) with tremors in the muscles of the limbs, head, neck and the back of the animals. The animals let down on the ground 3 minutes after injection. Nearly all body reflexes disappeared after propofol infusion. No anal or perennial reflexes by using strong stimuli. The eye reflexes disappear but the eye pupil reflex persist for 4 minutes
97
Universitatea de Științe Agricole și Medicină Veterinară Iași
then disappeared. Complete analgesia and sedation was achieved at 4 minutes after injection where the animals showed no responses to any painful stimuli. The heart rate in this group showed gradual increase from the preanesthetic value up to 20 minutes (Peak) then returned to normal 2 hour after injection as shown in table (1) The respiratory rate showed significant decrease 20 minutes after injection (without apnea) then returned back 3 hour after injection as shown in table (1) The body temperature showed significant decrease throughout the time of the anesthesia, this decrease of the body temperature was evidenced by shivering of the animals especially during the recumbancy period as shown in table (1) The recovery of the animals of this group characterized by shivering of the animals, both of the pedal and anal reflexes appeared at 39 minutes after propofol injection, long recumbancy period, the animal raise its head but still recumbent and finally the animal became in the standing position after several trails to stand, then complete recovery of the animals occurred at 95 minutes with tinny smooth recovery without any signs of nervous manifestation. Blood analysis: Blood analysis of the animals given propofol/ chloral hydrate was shown in table 2and 3. Haemogram: The red blood cells (RBCs) in this group showed non significant changes (7.70 ±1.82) when compared to the base line value (7.75 ±1.75) while the white blood cells (WBCs) showed gradual decrease (7.87 ±0.90) when compared to the base line value (8.30 ±0.92), as shown in table 8 and figure 36 and 37 respectively . The hemoglobin (Hb) showed non significant changes (12.34 ±0.85) when compared to the base line value (12.78 ±1.11) while the packed cell volume (PCV) showed gradual decrease (44.67 ±2.08)when compared to the base line value (46.33±2.52), as shown in table (2) . GPT showed gradual decrease (64.33 ±11.15) when compared to the base line value (69.00 ±11.14) while GOT showed non significant changes (64.00 ±38.97) when compared to the base line value (64.00 ±43.59), as shown in table (3) The cholesterol showed sudden increase 15 minutes after injection then gradual decrease (143.00 ±15.87) when compared to the base line value (148.67 ±15.53) and the total protein showed gradual decrease (5.87 ±0.78) when compared to the base line value (6.03 ±0.80) while the glucose level showed abrupt increase 15 minutes after injection then returned back to gradual increase (99.67 ±2.89) when compared to the base line value (73.33 ±10.97), as shown in table (3) The creatinine showed gradual decrease (1.44 ±0.25) when compared to the base line value (1.52 ±0.36) while the urea concentration showed increase (24.67 ±5.13) when compared to the base line value (22.67 ±5.03), as shown in table (3) The albumin showed non significant changes (2.64 ±0.36) when compared to the base line (2.76 ±0.30) while the A/G showed gradual increase (0.91 ±0.10) when compared to the base line (0.85 ±0.04), as shown in table (3)
98
Tim
e pa
rameters
0
5 10
20
30
60
120
180
Heart rate
63
±5.29
64.67
±18.15
67
±18.36
68
±16.82
64.67
±13.80
66.67
±13.32
58.33
±6.81
58.67
±7.64
Respiratory
18.67
±2.08
14
±2.65
13
±2.65
12.67
±2.52
14.67
±1.15
15.67
±1.53
15.67
±2.08
16.33
±0.58
Tempe
rature
37.47
±0.64
36.07
±0.12
36.2
±0.52
36.17
±0.38
36.23
±0.25
36.57
±0.31
36.6
±0.69
36.77
±0.49
Table (1): Show
ing the changes in th
e he
art , respiratory ra
te and
bod
y tempe
rature
Table ( 2
): Effect o
n bloo
d picture samples ( RB
Cs, W
BCs, Hb and PC
V)
Tim
e Pa
rameters
0 15
30
60
24h
RBCs
(million/cm
m )
7.75
±1.75
7.64
±1.58
7.70
±1.82
7.47
±1.39
7.64
±1.68
WBC
s (cell/cm
m)
8.30
±0.92
7.93
±1.01
7.87
±0.90
8.20
±0.66
8.40
±0.70
HB
(gm/dl)
12.78
±1.11
12.51
±0.71
12.34
±0.85
12.11
±0.88
12.00
±0.66
PCV %
46.33
±2.52
46.00
±1.00
44.67
±2.08
43.67
±3.21
47.00
±3.61
Lucrări Științifice – vol 53 seria Medicină Veterinară
99
Table (3): effect on liver and
kidne
y functio
ns of animals given prop
ofol / chloralhydrate
Tim
e Parameters
015
3060
24h
GPT
(u
/L)
69.00
±11.14
66.00
±12.49
64.33
±11.15
61.67
±9.50
66.00
±13.89
GOT
(u/L)
148.67
±15.53
154.33
±14.36
143.00
±15.87
147.67
±16.04
128.33
±11.85
Ch
olesterol
(mg/ dl)
64.00
±43.59
62.33
±35.28
64.00
±38.97
63.00
±40.71
59.00
±36.39
Creatinin
(mg/ dl)
1.52
±0.36
1.48
±0.33
1.44
±0.25
1.25
±0.16
1.39
±0.02
Total protein
(mg/dl)
6.03
±0.80
5.85
±0.75
5.78
±0.78
5.81
±0.86
5.90
±0.79
Glucose
(mg/dl)
73.33
±10.97
101.67
±11.02
99.67
±2.89
86.33
±12.70
94.33
±10.26
Urea
(mg/dl)
22.67
±5.03
24.67
±3.79
24.67
±5.13
25.67
±5.13
23.67
±4.16
Album
in
(gm/dl)
2.76
±0.30
2.66
±0.40
2.64
±0.36
2.76
±0.33
2.59
±0.38
A/G
%
0.85
±0.04
0.83
±0.07
0.84
±0.06
0.91
±0.10
0.79
±0.11
Universitatea de Științe Agricole și Medicină Veterinară Iași
100
Universitatea de Științe Agricole și Medicină Veterinară Iași
DISCUSSION
In this group we avoid the adverse effect of high induction dose of propofol by injection of chloral hydrate for induction of anesthesia, and then the maintenance of anesthesia was done by propofol infusion at rate of 0.2 mg/kg/minute. Chloral hydrate was relatively good hypnotic but poor analgesic as stated by Reid , et al. (1993) and this showed agreement with our results .
The induction of anesthesia in this group after injection of chloral hydrate was rapid with severe nervous manifestation as vigorous struggling, tremors and stiffness in head, neck and limbs. These finding were agreed with that recorded by Silverman and Muir (1993) , Field (1993) and El‐Sayad (2006).
In this group, the induction of anesthesia with chloral hydrate produced a bad quality induction, so the use of sedative tranquilizer to improve the bad condition of the induction of anesthesia as reported by (Silverman and Muir (1993).
The anesthesia was deep in all animals of that group and the duration of anesthesia was longer than that of propofol alone. This result supported by Silverman and Muir (1993), Field (1993) and El‐Sayad (2006). The adverse effect of high induction dose of propofol was avoided by injection of chloral hydrate, so the marked changes in cardio respiratory parameters were not observed, as the heart rate showed non significant increase in this group. This finding was similar to that stated by El‐Sayad (2006) in donkeys.
The respiratory rate in this group showed significant decrease at the first 20 minutes then returned back by time to the base line level. This result showed agreement with Field (1993) who added that the respiratory depression occurred in horses anesthetized with chloral hydrate.
The body temperature in this group showed significant decrease and this decrease was evidenced by shivering of all animals of this group, this similar to the finding of El‐Sayad (2006) in donkeys. In this group the recovery from combination of chloral hydrate and propofol was prolonged than that of propofol alone and this showed agreement with the results of Silverman and Muir (1993), Field (1993) and El‐Sayad (2006) in horses and donkeys respectively. Those authors added that the main disadvantage of chloral hydrate is that the dose required for inducing general anesthesia causes prolonged recovery.
The duration of recovery in this group was 95 minutes. The animal take long recumbancy time then begin to response to external stimuli, then raise the head but still recumbent, then attend to stand and complete recovery at 95 minutes. No nervous signs recorded. This was augmented by Silverman and Muir (1993), Field (1993) and El‐Sayad (2006) in horses and donkeys respectively. The use of chloral hydrate as induction drug with propofol infusion in donkeys produce bad quality induction anesthesia, but the anesthesia was deep with prolonged recovery. However the uses of chloral hydrate reduce the high induction dose of propofol, so reduce the adverse effect and the high cost of using propofol.
101
Lucrări Științifice – vol 53 seria Medicină Veterinară
REFERENCES
Arduino M. J., Bland L. A. and McAllister S. K. (1991): Microbial growth and endotoxin production in the intravenous
anaesthetic of propofol .Intec Control Hosp Epidem, 12: 535‐539. Branson K, R and M, E. Gross (1994): Propofol in veterinary medicine; J. Am .Vet. Med. Assoc,; 1292 ‐
1246. 204(12): 1888‐1890. El‐Sayad, A. M. M. (2006): Using of propofol as a general anesthetic in equine in comparison with other
anesthetics. M.V.Sc.Thesis. Tanta univ. Kafr‐El‐ sheikh branch Field, Sc. (1993): Cardiovascular and respiratory effects of propofol administration in hypovolemic dogs.
Am.J. Vet. Res.; 53: 2323 ‐2327. Fowler, CJ.(2004): "Possible involvement of the endocannabinoid system in the actions of three
clinically used drugs." Trends Pharmacol. Sci. Feb;25(2):59‐61. Haeseler G, Karst M, Foadi N, Gudehus S, Roeder A, Hecker H, Dengler R, Leuwer M.(2008): High‐
affinity blockade of voltage‐operated skeletal muscle and neuronal sodium channels by halogenated propofol analogues. British Journal of Pharmacology. Sep;155(2):265‐75.
Hui‐Chu Lin.;Ram,BC, And Tom,TA. (1997): Anesthesia in sheep with propofol or with xylazine ‐ ketamine followed by halofhane. Veterinary Surgery; 26: 247‐252.
Haeseler G, Leuwer M. (2003): High‐affinity block of voltage‐operated rat IIA neuronal sodium channels by 2,6 di‐tert‐butylphenol, a propofol analogue. European Journal of Anaesthesiology. Mar;20(3):220‐4.
Krasowski , Hong X., Hopfinger A.J, Harrison N.L. (2002): Analysis of a set of propofol analogues: mapping binding sites for an anesthetic phenol on the GABA(A) receptor. Journal of Medicinal Chemistry. Jul 18;45(15):3210‐21.
Muir W.W.,Hubell J.A., Bednarski R.M. and Sharda R.T. (2007): Hand Book of Veterinary Anesthesia: 4th Edn. Chap3. Mosby. An Affiliate of Elsevier Inc. Usa, PP: 140‐163. ISBN: (13‐978‐0‐323‐04678‐7), (10: 0‐323‐046789‐9). DOI. 987654321.URL.WWW.elsevier.com.
Reid, J.; Nolan AM. and Welsh, E. (1993): Propofol as induction agent in the goat: a pharmacokinetic study. J. Vet. Pharmacol. Ther. 16 (4): 488‐493.
Silverman, K. and Muir, M. (1993): Complications associated with general anesthesia of the horses. Vet. Clin. North Am; 3:45‐60.
Vanlersberghe C, Camu F. (2008): Propofol. Handbook of Experimental Pharmacology. ;(182):227‐52.
102
GENOTYPING ESTROGEN RECEPTOR POLYMORPHISM IN PIGS,
USING THE PCR‐RFLP METHOD
Adina Maria MANEA, S. E. GEORGESCU, Steliana KEVORKIAN, Sorina DINESCU, Marieta COSTACHE
University of Bucharest, Department of Biochemistry and Molecular Biology, Spl. Independentei 91‐95, sector 5, Bucharest
Abstract The efficiency of livestock production is highly influenced by reproductive success, especially in multipara species. In the case of the pig, litter size is a basic economic factor. Estrogen is intimately involved with pregnancy and its function is mediated through the estrogen receptor, therefore, ER was chosen as a candidate gene to study litter size in pigs. The goal of our study was to genotype the T1665C polymorphism in Landrace, Large White, Pietran and Mangalitza breeds using the PCR‐RFLP method. Our results showed that, by using this technique, it is easy to identify the homozygous (TT or CC), and heterozygous swine. The method presented above is reliable, fast and cost‐effective, and can be successfully applied in the marker‐assisted selection of the pigs.
Keywords: swine, estrogen receptor gene, polymorphism, PCR‐RFLP. INTRODUCTION Reproductive traits are of primary interest in livestock because they play a major role in the efficiency of production. Selection for increased number of offspring has been employed in model species like mice (Nielsen, 1994), pigs (Ollivier and Bolet, 1981; Lamberson et al., 1991; Bidanel et al., 1994) and sheep (Elsen et al., 1994) with only limited success because of the low heritability and the sex‐limited nature of reproductive traits. Steroid hormones and their receptors play an important role in reproductive processes (O'Malley, 1990). Cells in target tissues have receptor proteins that specifically bind the hormone during the initial stage in its action. Estrogen is intimately involved with pregnancy and its function is mediated through the estrogen receptor (ER). Mutations in this protein have been implicated in spontaneous abortion and in human breast cancer (Lehrer et al., 1990). It has been recently shown that transgenic mice containing a nonfunctional ER gene have considerable phenotypic changes in the reproductive system (Korach, 1994). Therefore, ER was chosen as a candidate gene to study litter size in pigs. The first association between the estrogen receptor gene and litter size was established by Rothschild et al in 1996. He highlighted a restriction fragment length polymorphism (RFLP) in the α‐estrogen receptor gene, T1665C, a polymorphism associated with reproductive traits, mainly litter size. The results obtained by Rothschild et al were later confirmed by Short et al (1997) and Chen et al (2000). In all three studies a positive association between allele B (C1665C) and litter size was highlighted. Our goal was to genotype this polymorphism in the Landrace, Large White, Pietran and Mangalitza breeds using the PCR‐RFLP method.
MATERIALS AND METHODS We used blood samples from 75 pigs of the Landrace, Large White, Pietran and Mangalitza breeds, (S.C. Romsuintest Periş, S.C. Suinprod S.A. Roman), preserved in EDTA anticoagulant.
103
Lucrări Științifice – vol 53 seria Medicină Veterinară
The isolation of genomic DNA from fresh blood was performed with Wizard Genomic DNA Extraction Kit (Promega). The PCR was performed using a GeneAmp 9700 PCR System (AppliedBiosystems). The reactions were carried out in 25‐μl final volume containing PCR Buffer, MgCl2, 800μM dNTP, 0.48 μM of each primer (F‐CCCTCTATGACCTGCTGCTG; R‐TCAGATTGTGGTGGGGAAGTC), 0.5 units of AmpliTaq Gold DNA Polymerase, diluted DNA and nuclease‐free water. PCRs were performed in 0.2 ml tubes by 40 cycles with denaturation at 95ºC (30s), annealing at 59°C (30s) and extension at 72°C (60s). The first denaturation step was of 10 minutes at 95ºC and the last extension was of 10 minutes at 72°C. PCR products were detected by electrophoresis in 2% agarose gel stained with ethidium bromide and then digested with restriction endonuclease AvaI at 37°C for 3 hours. Restricted products were analyzed by electrophoresis in 3.2% agarose gel stained with ethidium bromide. For sequencing, we used the same conditions as in the case of PCR. The amplified fragments were sequenced by ABI Prism 310 Genetic Analyzer, using the ABI Prism ® BigDye Terminator Cycle Sequencing Reaction Kit after purification with the Wizard System Kit (Promega). The sequences were processed using DNA Sequencing Analysis 5.1 Software (AppliedBiosytems) and the nucleotide sequences were aligned with the BioEdit program (Hall, 1999) and refined manually. RESULTS AND DISCUSSIONS For the identification of the T1665C SNP we used the PCR‐RFLP method. The set of primers was designed to amplify only a 185bp fragment from the α estrogen receptor gene that contains the T(1665)C SNP. This polymorphism creates a new recognition site for AvaI restriction endonuclease (C(T/C)TG(A/G)→C↓(T/C)CG(A/G)). The 185pb contains another restriction site for enzyme AvaI, at this site there is no other polymorphism and the enzyme will be cut at this level regardless of the animal genotype. We consider this site as a digestion control site. The PCR conditions were selected in such a way that the two primers could amplify the DNA from homozygote (TT or CC) and heterozygote animals. Successful amplification and digestion with AvaI yielded one, two, three or four fragments of 47, 60, 78 and 107 bp depending on the homozygote and heterozygote animals analyzed. For homozygoteTT pigs in the 1665 position we obtained two bands of 107 and 78bp and for homozygoteCC pigs we obtain three bands of 47, 60 and 78bp. In the case of a heterozygote animal, after the digestion with AvaI restriction endonuclease and electrophoresis, we obtain four bands of 47, 60, 78 and 107pb. In our study we identified homozygote (TT and CC) and heterozygote animals for the SNP T1665C (Figure 1).
Figure 1: Electrophoresis pattern of α estrogen receptor gene fragment after digestion with the AvaI enzyme. Lines 1, 3, 5, 6 – two fragments of 78 and 107pb, indicate homozygous TT pigs; Line 2 – four fragments of 47, 60, 78 and 107pb indicate heterozygous pigs; Line 4 –
three fragments of 47, 60 and 78pb indicate homozygous CC pigs; Line 7 ‐ uncut PCR product; Line 8 ‐ molecular size marker‐50bp (Promega).
104
Universitatea de Științe Agricole și Medicină Veterinară Iași
To confirm our results we sequenced the 185bp fragment from the α‐estrogen receptor gene. Figures 2 and 3 illustrate the profiles of the homozygous TT and CC pig from the region that contains the T1665C SNP.
Figure 2: The sequence of the region from the PCR product that contains the SNP T1665C
inside the recognition site for AvaI for a homozygousTT pig.
Figure 3: The sequence of the region from the PCR product that contains the SNP T1665C
inside the recognition site for AvaI for a homozygousCC pig. The sequence alignment between a region of the α‐estrogen receptor gene and our PCR products from the homozygous (TT and CC) pigs (figure 4) was done using BioEdit programme.
Figure 4: BioEdit fragment sequence alignment of a region of the estrogen receptor gene and our PCR products from homozygous (TT and CC) pigs. CONCLUSIONS The major focus of this study was to genotype the T1665C polymorphism from α‐estrogen receptor gene in the Landrace, Large White, Pietran and Mangalitza breeds using the PCR‐RFLP method. This method could help breeders in their forward selection strategy especially in the marker‐assisted selection. Our results showed that, by using this technique, it is easy to identify the animals which have the favorable allele for reproduction. The method presented above is reliable, fast and cost‐effective, and can be successfully applied in the wide‐scale screening of different pig populations.
105
Lucrări Științifice – vol 53 seria Medicină Veterinară
REFERENCES Nielsen MK (1994) Selection experiments for reproductive rate in mice Proceedings of the 5th World
Congress on Genetic Applied to Livestock Production (Univ. of Guelph, Guelph, ON, Canada), 19:219‐225.
Ollivier L and Bolet G (1981) La sélection sur la prolificité chez le porc: Résultats d'une expérience de sélection sur dix générations. J. Rech. Porcine France 13:261‐268.
Lamberson WR, Johnson RK, Zimmerman DR and Long TE (1991) Direct responses to selection for increased litter size, decreased age at puberty, or random selection following selection for ovulation rate in swine. J. Anim. Sci. 69:3129‐3143.
Bidanel JP, Gruand J and Legault C (1994) An overview of 20 years of selection for litter size in pig using “hyperprolific” scheme Proceedings of the 5th World Congress on Genetic Applied to Livestock Production (Univ. of Guelph, Guelph, ON, Canada), Vol. 17, pp. 512‐515.
Elsen JM, Bodin L, Francois D, Poivey JP and Teyssier J (1994) Genetic improvement of litter size in sheep Proceedings of the 5th World Congress on Genetic Applied to Livestock Production (Univ. of Guelph, Guelph, ON, Canada), Vol. 19, pp. 237‐243.
O'Malley B (1990) The steroid receptor superfamily: more excitement predicted for the future. Mol. Endocrinol,. 4, 363‐369.
Lehrer S, Sanchez M, Song HK, Dalton J, Levine F, Savoretti P, Thung SN. & Schachter B (1990) Oestrogen receptor β‐region polymorphism and spontaneous abortion in women with breast cancer. Lancet 335, 622‐624.
Korach KS. (1994) Insights from the study of animals lacking functional estrogen receptor. Science 266, 1524‐1527.
Chen KF, Huang LS, Li N, Zhang Q, Luo M, Wu CX (2000) The genetic effect of estrogen receptor (ESR) on litter size traits in pig. Yi Chuan Xue Bao 27:853–857.
Short TH, Rothschild MF, McLaren DG, Southwood OI, Devries AG, Van der Steen A, Tuggle CK, Helm J, Vaske DA, Mileham AJ, Plastow GS (1997) Effect of the estrogen receptor locus on reproduction and production traits in four commercial pig lines. Journal of Animal Science 75:3138–3142.
Rothschild MF, Jacobson C, Vaske D, Tuggle C, Wang L, Short TH, Eckardt G, Sasaki S, Vincent A, McLaren D, Southwood O, Van der Steen H, Mileham S and Plastow G (1996) The estrogen receptor locus is associated with a major gene influencing litter size in pigs. Proc. Natl. Acad. Sci. USA 93:201‐205
Hall TA. (1999) BioEdit: a user‐friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41:95‐98.
106
COMPARATIVE TESTING OF SOME EXPERIMENTAL MODELS OF
OXYGEN INDUCED RETINOPATHY IN YOUNG RATS. HISTOLOGICAL STUDY.
Miclăuş V1., Anne Claudia Ştefănuț2, Adriana Mureşan3,
C. Ober1, V. Rus1 1FACULTY OF VETERINARY MEDICINE CLUJ‐NAPOCA
2CLINIC EMERGENCY HOSPITAL CLUJ‐NAPOCA 3UNIVERSITY OF MEDICINE AND PHARMACY
”IULIU HAȚIEGANU” CLUJ‐NAPOCA, vmiclaus@usamvcluj.ro
Abstract: The influence of O2 concentration on the development and maturation of the retina was tested on two groups of newborn rats, one group subjected to hyperoxia and the other to variations of the concentration of O2 (hyperoxia/hypoxia). Results were assessed on histological sections. The occurrence of retinal cytoarchitectural changes in both experimental groups was observed, but with big differences between them. In case of group with hyperoxia, they appeared only in some animals (22%) and had regional character, while in group with hyperoxia/hypoxia, the procent was 100% and tended to generalize. These aspects demonstrate the negative effects of inadequate concentration of O2 on retinal development, variable concentration being more harmful than a constant hyperoxia.
Keywords: rat; retinopathy; histology
INTRODUCTION
The newborn rats have an immature visual system and the eyes are closed. After birth, the rat visual system gradually matures, the eye opening can be done after 14 days. Stage of development of retinal vascularization in newborn rat is comparable to that of an human premature L4‐5 month of gestation (Gyllensten and Hellström, 1954) and the retina is extremely immature at birth, comparable with that of a human fetus of 26 weeks . (Ricci, 1990). Retinal vascularization of newborn rats matures in the first two postnatal weeks (Cairns, 1959). Postnatal maturation of the visual system in rats, make that it can be used as an experimental model for diseases that can occur during the final period of retinal maturation. Maturation of human primary visual system is normally realised on intrauterine life (Dorfman et al. 2008). But in premature newborn, the final part of retinal development and maturation takes place extrauterine (in incubator) in circumstances that are sometimes different from those optimal, necessary to carry out this delicate process. In some cases, premature humans receiving high levels of O2 in order to compensate an unstable pulmonary status. But increased levels of oxygen, can cause severe vasoconstriction and vaso‐obliteration, followed by an abnormal proliferation of retinal vessels when it returned to normoxia, with the occurrence of oxygen‐induced retinopathy (OIR). Direct relationship between oxygen and OHR was supported by several authors (Michaelson, 1948, Campbell 1951, Ashton et al., 1954). Dorfman et al. (2008), confirmed the anterior studies that demonstrated increased susceptibility of the retina to hypoxemia in the first week of life, saying that in addition to vascular changes which may be reversible, cytoarchitectural irreversible retinal changes can occur. As in human subjects, exposure of young rats to postnatal hyperoxia can cause
107
Lucrări Științifice – vol 53 seria Medicină Veterinară
apparition of OIR (Smith et al., 1994; Reynaud et al., 1994; Madan and Penn 2003, Hardy et al., 2005). Some authors have argued that variation of oxygen concentration produces more severe retinopathy than just exposure to hyperoxia (Pennet al., 1993, Penn et al. 1995). Although there have been numerous investigations that have attempted to clarify the causes for the appearance of OIR, there are still many questions related to the etiology of this severe disease. MATERIALS AND METHODS Animals used in this study were white rats, Wistar race, female with newborns, with a birth weight of about 10g. Experimental study was performed at the Department of Physiology from University of Medicine and Pharmacy Cluj‐Napoca. Three groups were realised: a control group and two experimental groups. The control group was composed from a female rat and her newborn rats(7), which were placed in an incubator together with its mother, at 4 hours after birth, in conditions of normoxia for 21 days. Conditions of incubation: temperature 23‐24OC, cyclic exposure 12 day/12 darkness, using white artificial light 200 lux, feeding of newborn rats being ensured through maternal lactation, ad libitum from the mother. The first experimental group (hyperoxia group), consisting from a female rat and its 9 newborn rats, were placed in an incubator in conditions of normoxia for 7 days, then 5 days of hyperoxia (80%) and the last 9 days, in normoxia conditions again.The second experimental group (hyperoxia/hypoxia group), formed from a female rat and its 7 newborn rats, were placed in conditions of normoxia for 7 days, than then five days in alternating daily periods of hyperoxia (80% for 22 , 5ore) with hypoxia (10% for 1hr), and for hygiene of the incubator and mother feeding were used 0.5 hours.To achieve hyperoxia, a mobile oxygen concentrator adapted to the incubator was used, and hypoxia was achieved by placing the incubator in baroroom. Slaughter of the rats was performed on day 21, after a sedation with ketamine 6 mg/kgc (Oana et al. 2006). The eye globes were enucleated for histopathological examinations. An aproximatively 3 mm incision was made in the central area of the cornea (to facilitate penetration of fixative), then eye globes were fixed in Stieve mixture for 24 hours. Then the eye globes were sectioned at limbus, under microscopic control, carefully removing the cornea, lens and vitreous. The pieces were then dehydrated with ethyl alcohol, clarified with butyl alcohol (n‐butanol) and included in paraffin. Serial sections of 5μ thick were obtained, then its were stained with Goldner’s trichrome method. Examination of stained sections was made at an Olimpus BX41 microscope. RESULTS AND DISSCUTIONS Young rats from the control group, showed after 21 days from starting the experiment a normally developed retina, with typical layout in layers and normal vascularization (Fig. 1). In none of the animals from control group were not identified structural changes, suggesting that maintenace the rats under normoxia conditions, ensure appropriate conditions for normal development of the retina. In case of rats from experimental group with hyperoxia, retinal structural changes were observed in two of the nine rats studied. Changes were present in the photoreceptor cell layer and had regional character. Were also observed areas where, because of proliferation of photoreceptor cells, extern nuclear layer presents regional thickening, resulting in zonal retinal thickening, which appears protruding into the respective area (Fig. 2). In other areas, groups of photoreceptor cells migrated into the internal nuclear layer (Fig. 3), or toward the pigmented layer (Fig. 4) have been identified
108
Universitatea de Științe Agricole și Medicină Veterinară Iași
Another situation was observed in the second experimental group, the group with alternation hyperoxia / hypoxia. In this group retinal structural changes in all animals studied were identified.They are different regarding the extension from an animal to another, observing from changes with regional character to the tendency to generalize. Folds more or less deep were also observed, sometimes covering half of the thickness of the retina (Fig. 5). They are formed through zonal separation of photoreceptor cells, from the pigmented layer. In other areas, polymorphic rossetes both in shapes and sizes were observed. (Fig.6.). In some areas, structural disorganisation is so important, so that structural components appear mixed, with almost complete disappearance of the characteristic disposition on the layers (Fig.7). The vast majority of structural changes are irreversible. It seems that, largely, these structural changes are due to abnormal proliferation of blood vessels which appear large or very large in optical fibers layer (Fig. 8). Smaller vessels are detached from these large vessels, which penetrate deeper, where branched and appears to participate in structural disorganization, beginning with the photoreceptor cell layer, which is partial detached from the pigmented layer. Results obtained in this experiment reveal that prolonged exposure to hyperoxia caused the apparition of regional structural changes, mild or moderate in intensity in some animals taken in the experiment. Beauchamp et al. (2004) stated that continuous exposure to hyperoxia favors vasoconstriction with obliteration and stop developing vessels towards the retinal periphery in response to increased levels of O2. After returning to conditions of normoxia, an exaggerated neovascularization is unleashed, as a result of inadequate blood flow, a hypoxic one. (Moore, 1990, Patz and Payne, 1998). Comparing with hyperoxia, hyperoxia/hypoxia alternation induced severe cytoarchitectural changes having tendency of generalization, that seems to be largely determined by an excessive neovascularization. Somewhat similar results were reported by Penn et al. (1993) who said first that variations of O2 concentration, produce a more consistent retinopathy compared with constant concentrations (hyperoxia). In his experimental model (40/80 O2 concentrations), he obtained retinopathy in 66% of animals studied. By alternating exposure to O2, 50% one day, next day 10% in the first 14 days and then normoxia until day 20, neovascularization was obtained in 100% of animals taken in study (Penn et al. 1994, Berkowitz 1996). Similar results were obtained by Cummingham et al. (2000) in their experimental model in which rats were exposed 14 days at alternating concentrations of O2, followed by normoxia, with apparition of retinopathy in 100% of animals used in experiments. Dorfman (2008) argued that vascular changes may be reversible, but cytoarchitectural and functional retinal changes are irreversible. The aspects observed, confirmed that an inadequate concentration of O2 can negatively influence the development and maturation process of the retina.But these changes are dependent on oxygen concentration and especially on its concentration variation, aspects good highlighted in the two experimental models studied. In the group with hyperoxia, structural changes occurred only in some animals in the study, but these had a regional character and were not very severe. In case of model hyperoxia/hypoxia, retinal cytoarchitectural changes occurred in 100% of animals studied, although there were differences between them in terms of extention and severity of injuries. By comparing the results obtained in two experimental models, the fact that changes in oxygen concentration is more harmful than hyperoxia is confirmed.
109
Lucrări Științifice – vol 53 seria Medicină Veterinară
CONCLUSIONS 1. Results obtained in this experiment confirm that an inadequate O2 concentrations may adversely influence the development and maturation process of newborn rats retina, with appearance of cytoarchitectural changes, whose extension and severity are dependent on oxygen concentration and especially its concentration variations. 2. In case of group exposed to constant hyperoxia, only in 22% of animals studied moderate severity structural changes occurred, with regional character, affecting only a small part of photoreceptor cells. 3. In case of group exposed to hyperoxia/hypoxia, in 100% of animals studied appeared cytoarchitectural bilateral retinal changes, severe and in most cases with tendency of generalization and irreversible trend, with some differences from one animal to another. 4. By comparing the results obtained in two experimental models, is confirmed the fact that variation of oxygen concentration is more harmful than hyperoxia, causing severe and irreversible cytoarchitectural abnormalities, with retinal functional failure.
Fig.1. Control group ‐ normal structure (Goldner’s Trichrome ob. 40X)
Fig. 2. Hyperoxia group (Goldner’s Trichrome ob. 40X ) 1. Regional thickening of photoreceptor cells layer
2. Regional thickening of the retina
1
2
110
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 3. Hyperoxia group (Goldner’s Trichrome ob. 40X ) 1. Group of photoreceptor cells migrated in internal nuclear layer
Fig. 4. Hyperoxia group (Goldner’s Trichrome ob. 40X) 1. Group of photoreceptor cells migrated toward pigmented layer
1
1
111
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig.5. Hyperoxia/hypoxia group ( Goldner’s Trichrome ob. 40X)
1. Deep folds, 2. Regional thinness of the internal nuclear layer
Fig. 6. Hyperoxia/hypoxia group (Goldner’s Trichrome ob. 40X)
1. Polymorph rossetes 2. Regional disasapearance of the rods and cones
3.
Fig. 7. Hyperoxia/hypoxia group (Goldner’s Trichrome ob. 40X )
1. Structural disorganization of the 1‐5 layers 2. Regional thinness of the internal nuclear layer
1
2
1
2
1
2
112
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 8. Hyperoxia/hypoxia group (Goldner’s Trichrome ob. 40X)
1. Exaggerated angiogenesis 2. Polymorph rossetes
3. Regional disasapearance of the rods and cones REFERENCES
1. Ashton N, Ward B, Serpell G., Effect of oxygen on developing retinal vessels with particular reference to the problem of retrolental fibroplasia. Br J Ophthalmol 1954; 38:397‐432. 2. Beauchamp MH, Sennlaub F, Speranza G, et al. Redox‐dependent effects of nitric oxide on microvascular integrity in oxygen‐induced retinopathy. Free Radic Biol Med. 2004;37(11):1885–1894. 3. Berkowitz BA. Adult and newborn rat inner retinal oxygenation during carbogen and 100% oxygen breathing. Invest OphthalmolVis Sci. 1996;37:2089–2098. 4. Cairns J.E., Normal development of the hyaloid and retinal vessels in the rat”‐Brit. J. Ophthal.1959 43, 385 5. Campbell K., Intensive oxygen therapy as a possible cause of retrolental fibroplasia; a clinical approach. Med J Aust 1951;2:48‐50. 6. Cunningham S, McColm JR, Wade J, Sedowofia K, McIntosh N, Fleck B., A novel model of retinopathy of prematurity simulating preterm oxygen variability in the rat. Invest Ophthalmol Vis Sci 2000; 41:4275‐80. 7. Dorfman A, Dembinska O, Chemtob S, Lachapelle P., Early manifestations of postnatal hyperoxia on the retinal structure and function of the neonatal rat. Invest Ophthalmol Vis Sci, 2008, 49:458–466 8. Gyllensten LJ, Hellstrom BE., Experimental approach to the pathogenesis of retrolental fibroplasia. I. Changes of the eye induced by exposure of newborn mice to concentrated oxygen. Acta Paediatr Suppl 1954; 43:131‐48. 9. Hardy P, Beauchamp M, Sennlaub F, et al. New insights into the retinal circulation: inflammatory lipid mediators in ischemic retinopathy. Prostaglandins Leukot Essent Fatty Acids. 2005;72(5): 301–325. 10. Madan A, Penn JS. Animal models of oxygen‐induced retinopathy. Front Biosci 2003; 8:d1030‐43. 11. Michaelson I. The mode of development of the vascular system of the retina with some observations on its significance for certain retinal disorders. Trans Ophthalmol Soc UK 1948;68:137–80.
1
2
3
113
Lucrări Științifice – vol 53 seria Medicină Veterinară
12. Moore, A. (1990) Retinopathy of prematurity Taylor, D eds. Pediatric Ophthalmology 365‐375 Blackwell Scientific Boston.Patz A.The effect of oxygen on immature retinal vessels. Invest Ophthalmol Vis Sci 1965; 6:4:988‐999. 13. Oana L., A. Timen, Fl. Beteg, Anesteziologie şi propedeutică chirurgicală veterinară, Ed. Risoprint, 2006, Cluj‐Napoca. 14. Patz A, Payne, JW, Retinopathy of prematurity (retrolental fibroplasia) Tasman, W Jaegen, EA eds. Duane’s Foundations of Clinical Ophthalmology , (1998) 1‐19 Lippincott Williams & Wilkins Philadelphia. 15. Penn JS, Tolman BL, Lowery LA., Variable oxygen exposure causes preretinal neovascularization in the newborn rat. Invest Ophthalmol Vis Sci 1993; 34:576‐85. 16. Penn JS, Tolman BL, Henry MM., Oxygen‐induced retinopathy in the rat: relationship of retinal nonperfusion to subsequent neovascularization. Invest Ophthalmol Vis Sci 1994; 35:3429‐35. 17. Penn JS, Henry MM, Tolman BL. Exposure to alternating hypoxia and hyperoxia causes severe proliferative retinopathy in the newborn rat. Pediatr Res 1994; 36:724‐31. Erratum in: Pediatr Res 1995; 37:353. 18. Reynaud X, Dorey CK., Extraretinal neovascularization induced by hypoxic episodes in the neonatal rat. Invest Ophthalmol Vis Sci.1994;35(8):3169–3177. 19. Ricci B., Oxygen‐induced retinopathy in the rat model. Doc Ophthalmol. 1990;74(3):171–177. 20. Smith LE, Wesolowski E, McLellan A, Kostyk SK, D'Amato R, Sullivan R, D'Amore PA., Oxygen‐induced retinopathy in the mouse. Invest Ophthalmol Vis Sci 1994; 35:101‐11.
114
EXPRESSION OF THE VIMENTIN MARKER IN DOG MELANIC CUTANEOUS TUMORS
Moussa Raouad.,C Catoi., B Sevastre., M Taulescu.,
P Bolfă., A Gal., ,F.A Tabaran., A.L Nagy.,C CUC.
Pathology Department, Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary Medicine, Cluj‐Napoca, Romania,
Email:raouadmoussa@yahoo.com.
Vimentin is an intermediate filament that is expressed by mesenchymal and neuroectodermal cells in normal tissues.(4) Melanoma showed positive staining of intermediate filaments with antibodies to vimentin, with cells containing large numbers of melanosomes being stained less strongly in general. Vimentin is type of intermediate filaments can distinguish melanoma from undifferentiated carcinoma, but not from lymphoma or sarcoma.(2) Methods: We investigated the immunohistochemical expression Vimentin marker , in tumour tissues of 4 dog cutaneous melanomas and 2 dog cutaneous melanocytomas as possible evidence of marked cells by vimentin . In addition we investigated the relationship between vimentin expression and macroscopic,microscopic aspect. 6 cases were positive (2 melanocytoma, 4 melanomas), , 6 cases were positive (2melanocytoma,4melanoma). Percentag of marked cells by vimentin were between (65.18% – 97.40%).The high percentages of marked cells were in melanotic tumors no have connective activity. the high percentages were in melanotic tumors that localized in global eye and perineal region and moderate in a buccal region. I did,nt find legation between percentage of vimentin and tumor types (benign or malignant). Conclusions: the high percentage of vimentin immunoreactivity is in perineal and global eye region and in melanotic tumors no have connective.the moderate percentage is in buccal region and melanic tumors have a connective activity, and nu exist legation between tumor type and percentage of marked cells.
Key words: Immunohistochemistry, Vimentin, Melanic Tumors, Dog.
INTRODUCTION Vimentin (57 kDa) is the most ubiquituos intermediate filament protein and the first to be expressed during cell differentiation. All primitive cell types express vimentin but in most non‐mesenchymal cells it is replaced by other intermediate filament proteins during differentiation.(1‐3) Vimentin is expressed in a wide variety of mesenchymal cell types fibroblasts, endothelial cells etc., and in a number of other cell types derived from mesoderm, e.g., mesothelium and ovarian granulosa cells. However, in non‐vascular smooth muscle cells, vimentin is often replaced by desmin. In striated muscle, vimetin is also replaced by desmin. However, during regeneration, vimentin is reexpressed. Cells of the lymfo‐haemopoietic system (lymphocytes, macrophages etc.) also express vimentin, sometimes in scarce amounts. ( 3) Vimentin is also found in mesoderm derived epithelia, e.g. kidney (Bowman capsule), endometrium and ovary (surface epithelium), in myoepithelial cells (breast, salivary and sweat glands), an in thyroid gland epithelium. In these cell types, as in mesothelial cells, vimentin is coexpressed with cytokeratin. Furthermore, vimentin is detected in many cells from the neural
115
Lucrări Științifice – vol 53 seria Medicină Veterinară
crest. Particularly melanocytes express abundant vimentin. In glial cells vimentin is coexpressed with glial filament acidic protein (GFAP). (3) Vimentin is present in many different neoplasms but is particulary expressed in those originated from mesenchymal cells Sarcomas e.g., fibrosarcoma, malignt fibrous histiocytoma, angiosarcoma, and leio‐ and rhabdomyosarcoma, as well as lymphomas, malignant melanoma and schwannoma.(5‐6‐7) Melanoma showed positive staining of intermediate filaments with antibodies to vimentin, with cells containing large numbers of melanosomes being stained less strongly in general.(4) This type of intermediate filaments can distinguish melanoma from undifferentiated carcinoma, but not from lymphoma or sarcoma.(4) The aim of the present this paper is to use computerized image analysis to measure vimentin antibody in a series of canine melanocytic tumors to assess density of marked cells by vimentin, and to correlate percentage of marked cells by vimentin with macroscopic and microscopic aspect.
MATERIALS AND METHODS ●The material of our investigation was constituted of cadavers from the discipline of morphopathology and necropsy diagnostic, and also as samples sent from the surgery clinic and private practitioners, for diagnostic purpose. From all cadavers and samples examined between 2001– 2010, 6 cases were diagnosed with 4 dog cutaneous melanomas and 2 melanocytomas. ● The samples were formalin fixed, then tissue sections were stained with hematoxylin and eosin for histology study. ●For Immunohistochemistry (IHC), tissue sections of test samples were stained for CD31 (monoclonal Mouse Anti‐Vimentin Clone Vim 3B4, Code‐Nr.m7020, Dako Denmark A/S) and developed with the diaminobenzidine (DAB) chromogen. ●Percentage of marked cells was assessed randomly by choosing immunolabeled vessels on a 400x field (40x objective and 10x ocular) and using an automated image analysis system (Olympus cell B). 300 cells per tumor were examined. Images were captured by using a microscope (Olympus BX51) connected to a video camera (Olympus DP25), stored in the digital memory, and shown on the monitor. Manual outlining of pecentange of marked cells were then calculated based on image analysis.
RESULTS AND DISCUSSIONS
In the period 2001 – 2010 in the Pathology Department, were diagnosed 4 dog cutaneous melanoma and 2 dog cutaneous melanocytoma histological and with vimentin immunoreaction see to(Table 1)
116
Universitatea de Științe Agricole și Medicină Veterinară Iași
Table 1:Results of dog cutaneous melanotic tumors ( histological , CD31 immunoreaction) Number 81958 81693 78773 81783 81084 75688
HISTOLGY
Date 04 ‐02‐2010
15‐9‐2009
01.07.2005
03‐11‐2009
15‐11‐2008
25‐04‐2001
Breed Irish Setter
Doberman
Metis Tickle Giant schnauzer
‐
M/F… age
F 13 years
M 9 yeas
F 6 years F 7years M 9 years ‐
Region Buccal cavity
Mandibular
Cutaneous‐sacral,
Eye global
Neck in dorsal face
Knee
Diagnostic
Amelanotic melanoma
Junctoinal dermal amelanotic melanoma
dermal amelanotic Melanocyto
ma
amelanotic melanoma
Hyperplasia melanocytes (lentigo ) benign
Amelanotic melanoma
Cells microscopic type
Epithelioid type
Epithelioid type
Spindle type
Epithelioid type
Spindle cells
Epithelioid
Nr of mitosis
3 14 3 7 No 4
Lymphocyte infiltrate
intense intense reduced moderate
No reduced
Necrosis intense intense reduced reduced No reduced
Connective activity
Yes Yes No No Yes Yes
Clark's Clasification
4 4 4 4 ‐ 4
Vimentin
Percentage of marked cell
69.18% 64.012% 93,67% 97.40% 65.18% 77.54%
117
Lucrări Științifice – vol 53 seria Medicină Veterinară
Figure (1): Amelanotic melanocma immunoreactivety with vimentin that stained a lot of cells
in high‐power Field, black arrow indicates to marked cells by vimentin and white arrow indicate to fibroblast cell no marked by vimentin.(400x)
Figure (2) vimentin immunoreactivity with epithelioid melanoma that stained a moderate
percentage of cells Yellow arrows indicate to marked cells and white arrow indicate to cells no marked(400x).
Figure(3): melanocytoma immunorecativity with vimentin that marked a spindle type cells,
arrow indicates to these cells. (400x)
118
Universitatea de Științe Agricole și Medicină Veterinară Iași
Figure (4) vimentin immunoreactivity with epithelioid melanoma cells, yellow arrow indicate
to marked cells while white arrow indicate to fibroblast no marked . (1000x).
●6 cases were positive (2melanocytoma,4melanoma) ●Percentag of marked cells by vimentin were between (65.18% – 97.40%). ●The high percentages of marked cells were in melanotic tumors no have connective activity(fig1), but the moderate percentages were in melanotic tumors that have connective activity (fig 2) . ●The high percentages were in melanotic tumors that localized in global eye and perineal region (fig 1) But the moderate percentage were in melanotic tumors that localized in buccal region.(fig 2) ●Vimentin did,nt stain fibroblast cells and this is inverse what he said (refer‐3): Vimentin is expressed in a wide variety of mesenchymal cell types fibroblasts, endothelial cells etc.(3) fig‐4. ●I did,nt find legation between percentage of vimentin and tumor types (benign or malignant).
CONCLUSIONS
1. In the interval 2001 – 2010 six dogs were diagnosed with cutaneous melanocytic
tumours. 2. The affected dogs were between 6 and 14 years old. 3. 6 cases were vimentin positive (2 melanocytoma , 4 melanoma ) . 4. The high percentage of vimentin immunoreactivity is in perineal and global eye region
and the moderate percentage is in buccal region. 5. The high percentage of vimentin immunoreactivity is in melanotic tumors no have
connective(2 cases) activity and the moderate percentage is in melanic tumor have connective tissue(4 cases)
6. Vimentin doesn’t stain fibroblast 7. It isn’t exist legation between tumor type and percentage of marked cells by vimentin.
119
Lucrări Științifice – vol 53 seria Medicină Veterinară
REFERENCES 1‐ Azumi, N., Battifora, H. 1987‐ The distribution of vimentin and keratin in epithelial and nonepithelial neoplasms. A comprehensive immunohistochemical study on formalin‐ and alcohol‐fixed tumors. Am J Clin Pathol;88:286‐96.
2‐ Caselitz J, M Jänner, E Breitbart, K Weber, M Osborn., 1983 ‐ Malignant melanomas contain only the vimentin type of intermediate filaments. Virchows Arch A Pathol Anat Histopathol 400: 43‐51. 3‐ Katsumoto T., Mitsushima A., Kurimura T. 1990 ‐ "The role of the vimentin intermediate filaments in rat 3Y1 ):579‐84. 7‐ Ramaekers FCS, Vroom TM, Moesker O, et al. 1985 ‐ The use of antibodies to intermediate filament proteins in the differential diagnosis of lymphoma versus metastatic carcinoma. Histochem J.;17:57.cells elucidated by immunoelectron microscopy and computer‐graphic reconstruction". Biol Cell 68 (2): pp. 139–46. 4‐ koenig a, j. wojcieszyn, b. r. weeks, AND J. F. MODIANO.,2001‐ Expression of S100a, Vimentin, NSE, and Melan A/MART‐1 in Seven Canine Melanoma Cell Lines and Twenty‐nine Retrospective Cases of Canine Melanoma Vet Pathol 38:427–435 5‐ Lang SH, Hyde C, Reid IN, Hitchcock IS, Hart CA, Bryden AA, Villette JM, Stower MJ, Maitland NJ. . 2002 ‐ Enhanced expression of vimentin in motile prostate cell lines and in poorly differentiated and metastatic prostate carcinoma. Prostate Sep 1;52(4):253‐63.
6‐Niveditha SR, Bajaj P., 2003‐ Vimentin expression in breast carcinomas. Indian J Pathol Microbiol Oct;46(4).
120
ON THE SHAPE OF THE ERYTHROCYTES FROM SOME HERBIVORE MAMMALS
S.OANCEA1, G.PAVEL1, A.V.OANCEA2
1University of Agricultural Sciences and Veterinary Medicine, Iasi, lioancea@univagro‐iasi.ro 2“Al.I.Cuza”University, Iasi
The shape of a normal erythrocyte is a biconcave disc (discocyte) which represents an equilibrium state. Red cells can easily undergo shape transformations in vitro under the influence of certain agents and these changes are reversible by removal of causative agents by the addition of antagonists. On the other hand, there are some mammals which have elliptical erythrocytes as an adaptation to the environment and way of life. In this work the analysis of the erythrocyte shape for some herbivore mammals is presented. Our result shows that llama has only elliptical erythocytes, the cow and the sheep have discocytes but goat has a percent of 7.3% and goat kid 17.5% as elliptocytes. In addition the erythrocyte eccentricity has been computed and it is 0.87 for llama, 0.73 for goat and 0.77 for goat kid. Key words: mammal blood, RBCs, erythrocyte shape
INTRODUCTION
The shape of a normal erythrocyte is a biconcave disc (discocyte) which represents an equilibrium state. Red cells can easily undergo shape transformations in vitro under the influence of certain agents and these changes are reversible by removal of causative agents by the addition of antagonists. The mechanism by which mature red blood cells change their shape under physiological and pathological conditions has been the subject of considerable interest. The dominating interpretation of shape changes is explained by differential increase in surface area of the two leaflets of erythrocyte membrane.
Several groups have reported that drug‐induced shape changes of erythrocytes as elliptocytes are accompanied by alterations in their flow properties [1]. These alterations in the erythrocytes could be through direct modification of the cell geometry (surface to volume ratio) or through associated alteration of the membrane skeleton. Thus an inter‐relationship exists between the capacity of the cell for the shape change and the deformability of its membrane [2]. Erythrocytes in clinical conditions are associated with altered morphology leading to abnormal rheological behaviour, as observed in several hematological disorders. The inability of the erythrocyte to shape alteration contributes to its early removal from the circulation. Elliptocytes can be seen in hereditary disorders, such as hereditary elliptocytosis [3], or in acquired disorders, such as iron defiency anemia, infectious anemias, thalassemia, and in newborn babies. Hereditary elliptocytosis and its variants are congenital hemolytic disorders in which erythrocytes are either elongated into a cigar or oval shape or are poikilocytic and bizarrely shaped. Its transmission has usually been described as autosomal dominant.
On the other hand, there are animals which have normal erythrocytes with a different shape from discocytes. Therefore bird blood and fish blood contain elliptical erythrocytes [4].
121
Lucrări Științifice – vol 53 seria Medicină Veterinară
The elliptocytosis was detected a 5‐year‐old dog during the evaluation of lameness.
The dog's erythrocytes had reduced cellular deformability and erythrocyte membranes had decreased mechanical stability. Analysis of erythrocyte membrane spectrin revealed an increased amount of spectrin dimmers and DNA analysis detected a β‐spectrin mutation [5].
Other mammals have elliptocytes as an adaptation to the environment and way of life. Therefore it is theorized that the size, shape and hemoglobin concentration of camelid erythrocytes play a role in increasing the oxygen‐carrying capacity as well as the ability of erythrocytes to exchange oxygen. Camelid erythrocytes have a lower MCV than most other species, but a higher RBC count. PCV’s are similar to or slightly lower than other herbivores and total hemoglobin concentration in llama blood is high as compared to cattle. This is due to the combination of a higher concentration of hemoglobin in individual erythrocytes and the higher total RBC counts. The high hemoglobin concentration increases the ability of the cell to carry oxygen while the small size and flattened shape provide increased membrane surface for oxygen exchange (higher surface/volume ratio). In addition, it appears that camelid hemoglobin has characteristics that allow a higher saturation with hemoglobin at lower atmospheric oxygen pressure (left shift in the oxygen dissociation curve). The elliptical shape of the camelid erythrocytes also makes them much more resistant to changes in blood osmolality. In this work the analysis of the erythrocyte shape for some herbivore mammals is presented.
MATERIALS AND METHOD
Samples from peripheral mammal’s blood were operated using May‐Grüwald Giemsa colorature. With the aid of the microscope we obtained the photos and using erythrocyte planar images, we count the normal erythrocytes and the elliptocytes. After that the eccentricity of these elliptocytes has been determined using the well known formula:
2
21
a
be −=
where a and b are the ellipse semiaxes. Fig.1,2,3,4,5 shows the morphology of RBCs under normal conditions for blood of
some herbivore mammals. We can see that caw and sheep have normal discocytes, llama has elliptocytes and goat and goat kid have erythrocytes of various shapes in their blood.
Fig.1 Erythrocytes from cow blood
122
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig.2 Erythrocytes from sheep blood
Fig.3 Erythrocytes from llama blood
Fig.4 Erythrocytes from goat blood
123
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig.5 Erythrocytes from goat kid blood
RESULTS AND DISCUSSION
Fig. 6 shows the percentage of normal erythrocytes, elliptocytes and other shape of RBCs from some herbivore mammals.
0
20
40
60
80
100
120
cow sheep llama goat goat kid
%
discocytes
elliptocytes
other shape
Fig.6 The percentage of different shape of RBCs from herbivore mammals
0.6
0.65
0.7
0.75
0.8
0.85
0.9
0.95
llamagoatgoat kid
Fig.7 The eccentricity of elliptocytes from llama, goat and goat
kid Error bars are 95% confidence intervals and n=20
124
Universitatea de Științe Agricole și Medicină Veterinară Iași
Our results are in good accordance with the other authors for llama blood [6], as figure 8 and 9 show.
Fig.8 Erythrocytes from llama blood (Azwai et al.)
0.5
0.55
0.6
0.65
0.7
0.75
0.8
0.85
0.9
0.95
1
llama-personal resultsllama-literature
Fig.9 Comparison of the elliptocyte eccentricity from llama. Error bars are 95% confidence
intervals and n=20
Our results showed that the cow erythrocytes and sheep erythrocytes have discoidal shape, for llama the RBC are elliptocytes and for goat and goat kid blood appear elliptocytes and other different shapes. From aur samples resulted that goat blood has a percentage of 7,3% from cells as elliptocytes and 27% other shape, the rest of 65,7%being normal discocytes. For goat kid we obtained a higher percentage for elliptocytes (17,5%) than for goat, the other shapes being 11,3%, and discocytes71%.
From figure 7 we can see that the eccentricity of llama elliptocytes is 0.87 and it higher than the other animals (0.73 for goat and 0.77 for goat kid). The mean elliptocyte eccentricity for our samples is in accordance with the literature data (for these data we obtained a main elliptocyte eccentricity 0.901)
125
Lucrări Științifice – vol 53 seria Medicină Veterinară
CONCLUSION
Llamoid erythrocytes are elliptical and the elliptocyte eccentricity is higher than those
in other domestic animals studied in this work. The unique morphological features of llama erythrocytes play a vital role in their ability to transport oxygen to the tissue adequately on environmental conditions of high altitude. The goats and goat kids have also elliptical erythrocytes they being adapted to the special way of life by comparison with the other mammals. REFERENCES
1. Suwalskya M., Gonzáleza R., Fernando Villenab F., Aguilarc L.F., Sotomayor C.P, Bolognind S.,
Zatta P., (2009), Structural effects of tetrachloroauric acid on cell membranes and molecular models, Coordination Chemistry Reviews 253, 1599–1606
2. Maeda N, Nakajima T., Izumida Y., Suzuki Y., Tateishi N., Seiyama A., Decreased deformability of red cells refractory anemia and the abnormality of the membrane skeleton,(1994), Biorheology, 31(4), 395‐405.
3. Debray F.G. , Ilunga S. , Brichard B. , Chantrain C. , Scheiff J.M., Vermylen C., (2005), Une forme particulière d’anémie constitutionnelle chez un nourrisson de deux mois : l’elliptocytose.A particular hereditary anemia in a two‐month‐old infant: elliptocytosis, Archives de pédiatrie, 12, 163–167
4. Nash, G B., Egginton S., (1993), Comparative rheology of human and trout red blood cells, J. Exp. Biol., 174 ,109 – 122.
5. Di Terlizzi R., Gallagher P.G. , Mohandas N., Steiner L.A., Dolce K. S. , Guo X. , Wilkerson M.J., Stockham S.L., (2008), Canine elliptocytosis due to a mutant β‐spectrin, Veterinary Clinical Pathology, 38(1), 52 – 58
6. Azwai S.M., Abdouslam O.E., Al‐Bassam L.S., Al Dawek A.M., Al‐Izzi S.A.L., (2007), Morphological characteristics of blood cells in clinically normal adult llamas (Lama glama), Veterinarski Arhiv,77 (1), 69‐79
126
IDENTIFICATION OF PATHOLOGICAL STATES BASED ON RED
BLOOD CELL AGGREGATION
S.OANCEA1, S.PADUREANU1, A.V.OANCEA2
1University of Agricultural Sciences and Veterinary Medicine, Iasi, lioancea@univagro‐iasi.ro 2“Al.I.Cuza”University, Iasi
In the present study the aggregation properties of cow RBCs were investigated. For cow, in physiological conditions, the aggregation is not present but in pathological cases a hyper aggregation process can be seen. In order to appreciate the RBC aggregation the Aggregate Shape Parameter has been computed using AUTOCAD soft
Key words: RBC aggregability, cow blood, AUTOCAD soft INTRODUCTION
In human blood and for almost all mammals, RBCs are biconcave disks under normal physiological conditions, whereas their mean size may differ between species. RBCs in static human blood form large aggregates resembling a stack of coins but aggregation characteristics of mammalian RBC exhibit a wide range among various species. More investigators are playing a good deal of attention of research on blood viscosity to clinic, the aggregation of red blood cell may be a more useful parameter of hemorheology from point of view of pathology and diagnostic [1]. Comparative animal studies showed the wide variation of whole blood and erythrocyte aggregation among different mammalian species [2]. Horse RBCs aggregation was reported by many authors [3] and it is greater than for the other mammalian species. Popel et al. data [4] showed that athletic species exhibit a consistently higher degree of red blood cell aggregation than their sedentary counterparts. There are different methods to evaluate this complex process of RBC aggregation [5], [6]. In [7] the fractal analysis was used to make a quantitative evaluation of aggregability for horse blood by comparison with the human blood and in [8] the same method was used for bovine blood from pathological point of view. Traditional mechanical and mathematical methods also proved to be insufficient in describing the aggregation process [9].
In this work the aggregation process of cow RBCs was investigated. In order to appreciate the RBC aggregation the Aggregate Shape Parameter has been computed using AUTOCAD soft.
MATERIALS AND METHOD
Samples from peripheral bovine blood were operated using May‐Grüwald Giemsa
colorature. With the aid of the microscope we obtained the photos. Using erythrocyte planar images of the clusters, obtained with a Nikon microscope, the RBC Aggregate Shape Parameter was computed using the formula [10]:
24
PAK π= (1)
127
Lucrări Științifice – vol 53 seria Medicină Veterinară
Here A is the projected area of the aggregate and P is its perimeter. These quantities
were computed by means of AUTOCAD 2007 soft. RESULTS AND DISCUSSION
Fig.1 shows the morphology of RBCs under normal conditions for cow blood when the RBCs are not aggregated and Fig. 2 shows aggregated erthrocytes.
Fig.1 Erythrocytes from cow blood
Fig.2 Aggregated erythrocytes from cow blood
Our measurements for 5 aggregates (from 5 photos) on the Aggregate Shape Parameter are given in the table 1.
128
Universitatea de Științe Agricole și Medicină Veterinară Iași
Table 1 Aggregate Shape Parameter for cow blood
Nr A P K 1 149974.62 1978.21 0.4813 2 155554.0 2663.97 0.2753 3 159709.67 2471.86 0.3283 4 68678.54 1112.6 0.6968 5 193315.05 2815.65 0.3062 Mean 0.4176Standard deviation 0.1751Standard error 0.0783Confidence interval 0.2174
The Aggregate Shape Parameter for cow blood in this pathological state is higher than
the other animals studied in the earlier work [11], as figure 3 shows.
Fig.3 Comparative aggregation for three mammals
Fig.3 The Aggregate Shape Parameter for some mammal’s blood. Error bars are 95% confidence intervals and n=5
CONCLUSION
We can suppose that if we develop an easy method to measure the RBC aggregation
in pathological states for some mammals and we could perform standardization, we could obtain a method to find the stage of the disease.
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
variants
aggr
egat
ion
shap
e pa
ram
eter
horsepigcow
129
Lucrări Științifice – vol 53 seria Medicină Veterinară
REFERENCES
1. Rampling, M.W., Meiselman, H.J. Neu B., Baskurt O.K, (2004), Influence of cell‐specific factors
on red blood cell agregation, Biorheology, 41, 91‐112. 2. Kumavarel, M., Singh M., (1995), Sequential analysis of aggregation process of erytrocytes of
human, buffalo, cow, horse, goat and rabbit, Clinical Hemorheology, 15, 291 – 304. 3. Baskurt O.K., Farley R.A., Meiselman H.J., (1997), Erythrocyte aggregation tendency and
cellular properties in horse, human and rat: a comparative study, Am. J., Physiol., 273, H2604‐H2612.
4. Popel A.S., Johnson P.C., Kameneva M.V., Wild M.A., (1994), Capacity for red blood cell aggregation is higher in athletic mammalian species than in sedentary species, J. Appl. Physiology, 77, 1790‐1794.
5. Marton Z., Kesmarky G., Vekasi J., Cser A., Russai R., Horvath B., Toth K., (2001), Red blood cell aggregation measurements in whole blood and in fibrinogen solutions by different methods, Clinical Hemorheology and Microcirculation, 24, 75‐83.
6. Rapa A., OANCEA S., (2006), Hemoreologie comparata, Editura TEHNOPRESS 7. Rapa A., OANCEA S., CREANGA D.,(2005), Fractal dimension in red blood cell, J.of Veterinary
and Animal Science, 29, 1247‐1253. 8. Oancea, S., (2007), A quantitative analysis of red blood cell aggregation from bovine blood,
Romanian Journal of Biophysics, 17(3), 205‐209. 9. Skalak R., ZHU C.,(1990), Rheological Aspects of Red Blood Cell Aggregation, Biorheology, 27,
309‐325. 10. Foresto P., D’Arrigo M., Carreras L., Cuezzo R.E., Valverde J., Rasia R., (2000), Evaluation of
red blood cell aggregation in diabetes by computarized image analysis, Medicina (Buenos Aires), 60, 570‐572.
11. Oancea S., Oancea A.V., (2010), Erythrocyte aggregation for two species of mammals, Romanian Journal of Biophysics, in print
130
STRUCTURAL MODIFICATIONS OF THE ORAL MUCOSA AND THE DENTAL APPARATUS INDUCED BY
SOME DRUGS IN LABORATORY MICE
OPREAN O.Z.1 , GHEBAN DIANA2 , FORNA NORINA CONSUELA2, ŞINDILAR E.V.1, GRĂMADĂ S.1
1Veterinary Medicine Faculty, Iaşi 2Dental Medicine Faculty, Iaşi e‐mail: ozoprean@uaiasi.ro
Abstract
The authors aim to verify and study the information mentioned in speciality literature on induced side effects, (in mammals) in the oral cavity, of 3 drugs: Phenytoin, Cyclosporin, Nifedipine. The research was conducted on 36 white laboratory mice (subfamily Murinae) distributed in groups of 12 animals each for each product, and a control group of 5 animals, to which no action was taken. The fundamental pathological process observed in histological examination, with no significant differences in the groups, was fibrocellular hyperplasia. No relevant tissue reaction differences were observed in animals injected with Azithromycin, well‐known antitoxin for the three drugs tested. Keywords: experiment, Phenytoin, Cyclosporin, Nifedipine, fibrocellular hyperplasia. The research performed on experience animals suggest side effects of some drug
compounds, very often used in human pathology, consisting of important structural alterations of the oral mucosa and of the dental apparatus. We intend to verify and deepen the information available in the litterature concerining side effects induced to the oral cavity by the overdose/prolonged utilisation of three chemical compounds: Phenytoin, Cyclosporin, Nifedipine
Phenytoin has as main therapeutic indications the treatment of major epileptic crises (generalised lonicodonic crises) and of partial crises, especially jacksonian ones, but also in the prophylaxy of epileptic crises secondary to neurosurgery. (1,5,9)
Cyclosporine (also known as Cyclosporine A) is a cyclic polypeptide, consisting of 11 aminoacids, well known as a strong immunosupressive agent, which in animals leads to a prolongement of the survival of allogenic skin, heart, kidney, pancreas, bone marrow, intestin or lung transplants, thus having therapeutical indications in transplant protection and in autoimmune disease. (2,4,10)
Nifedipine is a slow calcium channels blocker; it has an inhibitor effect on calcium ions flows, especially in myocardic cells and in the cells of the smooth muscle in the walls of coronary artheries and peripheric blood vessels. It is recommended in the treatment of pectoral angina and in the chronic treatment of the essential and secondary hypertension. (3,6,7,8)
Side effects of these three drugs, more serious in children, consist of dysfunctions of the main internal organs, skin and blood.
1. MATERIAL AND METHOD
36 white laboratory mice were divided in groups of 12 (6+6) animals for each tested drug,
and marked cromatically according to Table 1.
131
Lucrări Științifice – vol 53 seria Medicină Veterinară
Table 1 Repartisation of experience animals in groups and experiment accomplishment
*F=Phenytoin; C = Cyclosporine A; N = Niphedipine; Azy = Azytromicine For each of the drugs, we also formed one group in which the drug was administered in
association with Azytromicine, that has a well known role as a moderator (antitoxic) for the 3 tested drugs.
We also had a witness group, with 5 congenere animals that did not suffer any intervention. Experimental animals were all 20 days old males weighing 30 g each, that had their
digestive flora supressed through two daily administrations per os of 0,1ml peniciline solution 40.000 UI/ml, preceeding the experiment.
The drugs were administered through gavage, Phenytoine and Niphedipine as aquous solution 2mg/ml, Cyclosporine A solubilised in saline solution 2mg/ml.
Mice in Lot F1 were administered Phenytoine 20mg/kg/day, for 55 days, and Lot F2 were added 10mg/kg/day Azytromicine.
Lot C1 received 10mg/kg/day Cyclosporine A, and Lot C2 10mg/kg/day Cyclosporine A and 10mg/kg/day Azytromicine.
Lot N1 was administered Niphedypine 150mg/kg/day, for 7 days and 250mg/kg/day, for 13 days.
Lot N2 received Niphedypine the same way as N1, associated to 10mg/kg/day Azytromicine. on o important on otice that in Lot C1 one animal died, in apparent health, in day 10 of
the experiment. All animals were euthanised at the end of the experiment, using T‐61 as euthanasia agent. 2. RESULTS AND DISCUSSIONS
Interpretation of the different deviations from the morphological normal, induced by the 3
drugs previously described was done accordingl;y to the normal aspect of the oral mucosa noticed in the mice in the witness group. Transverse sections through lateral walls of the oral cavity (cheek area) seveals, on the internal side, the structure of the oral mucosa, covered with a keratinised stratified pavimentous epithelium, resembling the one on the exterior side of the cheeks. The anterior segment of the oral cavity is less developped and the muscular support of the area is represented by isolated fascicles of scheletical muscle fibers. (Fig.1, Fig.2).
Group Active substance administered*
Administration period(days)
Dose (mg/kg/day)
F1 F 55
20
F2 F + Azy F 20
Azy 10 C1 C
35 10
C2 C + Azy C 10 Azy 10
N1 N 7 150 13 250
N2 N + Azy 7
N 150 Azy 10
13 N 250 Azy 10
132
Universitatea de Științe Agricole și Medicină Veterinară Iași
The superficial epithelium of the oral mucosa on the internal side of the lips, cheeks and at gingival level is a medium keratinised pavimentous epithelium, with a report cornous layer / Malpighi layer of about 1/3 (Fig.3).
The profound area of the oral cavity, the submucosa is developped, consisting of fascicles of non‐oriented colagen fibers (Fig.4).
Toward the pharyngian area, the musculosa is very well developped and reaches sometimes the subepithelial space (Fig.5).
Lingual mucosa presents onits dorsal side several papiliform papillae, and the musculosa obviously predominates in the structure of the tongue, being made of scheletic muscle fibers (Fig.6, Fig.7, Fig.8).
The tooth is made of two macrostructural segments: the crown is the fragment projected in the oral cavity and protected my an enamel layer; the root is the portion implanted in the dental alveola and is protected by a cement layer.
2.1.Changes of the oral mucosa In all 3 drugs studied we noticed reactive‐inflammatory hyperplasia, with subacute‐chronic
evolution. Necropsic examination does not evidentiate relevant modifications, histopathological
examination evidentiate fibro‐cellular prolifferations in all structural segments of the oral mucosa. Superficial epithelium suffers from a moderate hyperplasia of the Malpighi layer, the report
keratine/spinous layers becoming about 1/6 (Fig.9). In some areas, the hyperplasia of the spinous layer is produced in a centripete direction, as
papillae that protrude in the lamina propria (Fig.10). In some cases of mice injected with Cyclosporine and Niphedypine proliferation of the
submucosa and of the superficial epithelium is associated in the form of micropollipes that proeminate on the surface of the oral mucosa (Fig.11).
One animal in Lot N1 has a hyperplasiated mucosa that sticks to the dental surface, as papillae reaching the top of the dental crown (Fig.12, Fig.13).
The papillae of the mucosa are anchored to the surface through a wide base, on which the report keratine/spinous layers is about 1/8 (Fig.14).
The oral submucosa is affected by the same fundamental pathological process. The hyperplasia, initally vasculo‐conjunctive, becomes predominantly fibrous in time, towards the pharyngian area of the oral cavity The local mesenchyme prolifferates as thick unoriented colagenic fascicles (Fig.15, Fig.16).
In 2 cases we noticed tissular reactions with accute‐subacute evolution, due to local irritations or oportunistic bacteria. In one case we described edematous peridontal infiltrations, and subepithelial necrotic foci (Fig.17, Fig.18).
2.2. Alterations of the dental apparatus Moderate hyperplastic tissular reactions also extend to the dental apparatus. Dental alveolae show a fibrous hyperplasia finalised in a band of conjunctive tissue, dense
and well vascularised that separates the root from the bone support of the dental arcade (Fig.19). The proximal segment of the root show areas of dentine vacuolisation, whereas in the distal
area of tooth anchoration shows a conjunctive hyperplasia and a disjunction of the root from the bone structures (Fig.20, Fig.21).
Structural components of the tooth also show deviations from the morphological normal: the dentine and the cement appear striated by void canalicles, while dental pulp is the place of a lymphohistiocytic and later fibrous hyperplasia (Fig.22, Fig.23).
2.3. Alterations of the internal organs One mouse of din Lot C1 died in apparent health in day 10 of the experiment. Histological
examination of tissular fragments prelevated from the main internal organs reveal changes dued to acute‐subacute toxicosis.
133
Lucrări Științifice – vol 53 seria Medicină Veterinară
Low resolution microscopical examination of the lung evidentiates the ectasy and hematic overload of small and medium blood vessels and tissular densifications lodged in interalveolar interstitium (Fig.24).
Thickening of the interalveolar septum is accompanied by hyperplasia of the distal airwaves, that present 3‐4 rows of cells (Fig.25).
The heart is the place of changes with two structural localisations: interstitial (vascular) and parenchimatous.
Vascular, we notice periartheriolar edematous infiltrations that dissociate the blood vessels from the cardiac muscle fibers and enter the vascular wall, dissectig the vascular adventice. The leyocites in the parietal media are thick with inflated vacuolised nuclei; vascular endothelium appears tumefected, and the nuclei of the endothelial cells are bigger and hyperchromatic, proeminating in the vascular lumen (Fig.26).
The parenchyme is the place of intracellular deposits of calium ions, with typical aspects of localised calcification: intracellular amorpheous surfaces, intensely haematoxylinic in HEA staining; calcifications are focalised on oxyfile myocardic areas, specific to tissular devitalisation (Fig.27).
The liver is affected by circulatory disorders and dismethabolies pretty unspecific, but which, in association, lead to a common toxic etiology: passive liver congestion and granulo‐lipidic hepatosis.
Passive liver congestion is translated through the ectasy and overload of centrolobular venulae and dilatation of sinusoidal capillaries through erythrocytes partially hemolised and conglomerates (Fig.28).
Granulo‐lipidic hepatosis consists on one hand of the tumefaction of hepatocytes and the trubled aspect of their cytoplasms, and on the other hand of the spongeous aspect and even the apparition of well circumscribed intracitoplasmatic valuolae (Fig.29).
Cellular sufference is also suggested by the aspect of the nuclei of the hepatocytes: raspberry aspect, corical hyperchromatosis, chromatine condensation in hyperchromatic blocks (Fig.30, Fig.31).
The cortical of the kidneys show tumefaction and intumescence of the renoepitheliums that leads to the anullation of the urinifer tubes, changes of granulas nephrosis; we also noticed the hyperplasia of vascular areas of Malpighi corpuscles, that completely anullate glomerular cavities. (Fig.32).
CHART I
Fig. 1. Transverse section in cheek area. Mouse. HEA, x100
Fig. 2. Oral mucosa. Mouse. HEA, x400
134
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 3. Oral mucosa, Pavimentous stratified keratinized epithelium. HEA, x400
Fig. 4. Oral cavity. Submucosa. Musculosa. HEA, x400
Fig. 5. Oral cavity, pharingeal area. Musculosa. HEA, x400
Fig. 6. Lingual mucosa, ventral side.HEA, x400
Fig. 7. Lingual mucosa, dorsal side. Filiform papillae HEA, x400
Fig. 8. Lingual musculosa. Rabdocytes. HEA, x400
CHART II
Fig. 9. Superficial epithelium. Hyperplasia of the spinous layer. Ration
eratinised/spinous layers of 1/6. HEA, x400
Fig. 10. Superficial epithelium. Centripete papillar hyperplasia of the spinous layer.
HEA, x400
135
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 11. Hyperplasia of the submucosa and of the spinous layer. HEA, x400
Fig. 12. Periodontal hyperplasia of the mucosa. Premolar. HEA, x40
Fig. 13. Periodontal pollipe. HEA, x100 Fig. 14. Base of the periodontal polipe. Hyperplasia of the spinous layer. HEA, x400
Fig. 15. Colagenised vasculated submucosa . HEA, x100
Fig. 16. Colagenised submucosa, Pharyngeal area of the oral cavity. HEA, x400
CHART III
136
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 17. Periodontal edematous infiltrations. Col. HEA, x100
Fig. 18. Subepithelial necrosis. HEA, x400
Fig. 19. Molar. Bifide root. Longitudinal section. Colagenization of the dental alveola.
HEA, x100
Fig. 20. Molar. Bifide root. Transverse section. Dentine vacuolisation. HEA, x100
Fig. 21. Molar. Bifide root, profound area. Transverse section. Alveola decolation.
HEA, x100
Fig. 22. Premolar. Dental crown, Cement canalisation. HEA, x400
Fig. 23. Premolar. Fibrous hyperplasia of dental pulp. HEA, x400
Fig. 24. Lung. Tissular condensation with septal hyperplasia HEA, x100
137
Lucrări Științifice – vol 53 seria Medicină Veterinară
CHART IV
Fig. 25. Lung. Hyperplasia of bronchiolar epithelium. HEA, x400
Fig. 26. Heart. Artheriole. Leyocite tumefaction and of the vascular endothelium.
HEA, x1000
Fig. 27. Heart. Dystriphic calcification area. HEA, x400
Fig. 28. Liver. Passive congestion. HEA, x100
Fig. 29. Liver. Granulo‐lipidic dystrophy. HEA, x100
Fig. 30. Liver. Hyperchromatic nuclei. HEA, x1000
138
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 31. Liver. Nuclear hyperchromatosis. Spongious cytoplasm. HEA, x1000
Fig. 32. Kidney. Hyperplasia of renal glomerules. HEA, x400
3. CONCLUSIONS The testing of secondary effects with oral localisation of the three drugs: Phenytoin,
Cyclosporin, Nifedipine , on white lab mice revealed the following conclusions: 1.Necropsic examination did not reveal macroscopical lesions. 2.The fundamental pathological process noticed histologically was the fibrocellular
hyperplasia, for all groups and at all levels of the oral cavity. 3. The access of the pathogen factor on the circulatory way leads to the hyperplasia of
profound and median structures of the oral mucosa, while the superficial keratinized layer stays the same. The spinous layer of the epithelium thickens up to a ratio of 1/6. Lamina propria and the submucosa are the place of a predominantly fibrous hyperplasia, finalised by the thickening of affected areas and replacement of glandular tsructures through dense and well irrigated connective tissue. Mucosal hyperplasia may lead to formation of pollipes adherrent to the lateral surfaces of the tooth.
4.The dental apparatus is moderately affected by the same predominantly prolifferative phenomena. The dental alveola is colagenised, leading, in profound areas of the dental root, to its disjunction from the bone support of the region. The dentine and the cement are marked of fine canallicles, while dental pulp suffers a hyperplasia (predominantly cellular, then fibrous).
5.We did not notice any relevant differences in the animals injected with Azytromicine. 6.In one case that was administered CyclosporinaneA (no Azytromicine) and died in
apparent halh in day 10 of the experiment, we noticed changes due to an acute‐subacute toxicosis, and local circulatory disorders due to myocardic calcification.
7. In 2 of the cases we described edematous periodontal infiltrations and subepithelial necrotic foci, due to local irritations or opportunistic bacteria.
BIBLIOGRAPHY 1. Balaji S (October 2004). "Medical therapy for sudden death". Pediatr. Clin. North Am. 51
(5): 1379–87; 2. Borel JF (2002). "History of the discovery of cyclosporin and of its early pharmacological
development". Wien. Klin. Wochenschr. 114 (12): 433–7. PMID 12422576;Cohn, J.N., Ziesche, S.M., Loss, L.E., Anderson, G.F., si V‐HeFT Study Group, Effect of felodipine on short‐term exercise and neurohormone and long‐term mortality in heart failure: results of V‐HeFT III (rezumat), Circulation, 1995, 92(supl.I), I143;
4. Dewick, P. (2001) Medicinal Natural Products. John Wiley & Sons, Ltd. 2nd ed.;
139
Lucrări Științifice – vol 53 seria Medicină Veterinară
5. Dreyfus, Jack (1998). A Remarkable Medicine Has Been Overlooked: Including an Autobiography and the Clinical Section of the Broad Range of Use of Phenytoin. Continuum International Publishing Group. ISBN 0‐8264‐1069‐3;
6. Furberg, C.D., Psaty, B.M., Mejer, J.V., Nifedipine. Dose‐related increase in mortality in patients with coronary heart disease, Circulation, 1995, 92, 1326‐1331;
7. Lewis, B.S., Emmott, S.N., Smyllie, J., MacNeil, A.B., Lubsen, J., Left ventricular systolic and dyastolic function, and exercise capacity six to eight weeks after acute myocardial infarction, Am J Cardiol, 1993, 72, 149‐153;
8. Maisch, B., Brilla, C., si Kruse, T., Directions in antihypertensive treatment ‐ our future from the past, Eur Heart J, 1995, 16(supl.C), 74‐83;
9. Man CB, Kwan P, Baum L, et al. (May 2007). "Association between HLA‐B*1502 allele and antiepileptic drug‐induced cutaneous reactions in Han Chinese". Epilepsia 48 (5): 1015–8.;
10. Starzl TE, Klintmalm GB, Porter KA, Iwatsuki S, Schröter GP (1981). "Liver transplantation with use of cyclosporin a and prednisone". N. Engl. J. Med. 305 (5): 266–9. PMID 7017414.
140
ISOLATION, CHARACTERIZATION, PHENOTYPIZATION AND DIFFERENTIATION OF STEM CELLS FROM RAT PLACENTA
Emoke Pall1, Groza I.1, Cenariu M.1, Cristina Ilea1,
Olga Soritau2, Ciprian T2., Berce C1. 1.University of Agricultural Science and Veterinary
Medicine, Cluj‐Napoca, 3‐5 Calea Mănăştur, Cluj‐Napoca, pallemoke@gmail.com
2.Oncology Institute Prof.Dr.Ioan Chiricuta, Cluj‐Napoca
Abstract: Mesenchymal stem cells have been successfully isolated from human, cat, dog, rabbit, rat, chicken, sheep, goat and pig bone marrows thanks to their plastic adherence property. In recent years, stem cell biology has sparked considerable interest worldwide in the scientific world, and recent developments in stem cell research have opened new perspectives by using them in regenerative therapy. In this study we successfully isolated, cultured and expanded rat placenta‐derived mesenchymal stem cells using routine methods. After the initial 3 days of primary culture, rat placental mesenchymal stem cells adhered to a plastic surface and presented a small population of single cells with spindle shape. To investigate the mesenchymal mature we differentiated the cells into the osteoblastic lineage and also the expression of certain surface marker.
KEYWORDS: placenta, mesenchymal stem cells, culture expansion, differentiation
Stem cell research has become an important field of study for molecular, cellular, and clinical biology as well as pharmaco‐toxicology. Indeed, stem cells have a strong proliferative and unlimited self‐renewal potential and are multipotent (1,4,6,7) The mesenchymal stem cells (MSC) are multipotent cells present in the bone marrow and other tissue (3). The plasticity of these cells allows them to be used in cell therapy once they have the potencial to replicate as undifferentiated cells and could be induced to differentiate to mesenchymal lineages (bone, fat, cartilage, tendon, muscle, marrow stroma etc.) as endodermal and ectodermal lineages, replacing tissues and organs whose function had been harmed. All the species could be benefied using the cell therapy (2,5). Rat mesenchymal stem cells from placenta offer significant promise as a multipotent source for cell‐based therapies and could form the basis for the differentiation and cultivation of tissue grafts to replace damaged tissue. Placental derived MSC therefore represent an alternative and more easily obtainable and abundant source of MSC than bone marrow.
The aim of this study was to isolate and evaluate the differential potential of mesenchymal stem cells from rats placentas. Our data demonstrate that we successfully
isolated, culture‐expanded mesenchymal stem cells from rat placentas.
MATERIALS AND METHODS Biological material placentas were obtained after caesarean section from normal term
pregnancies (19‐21D) Pieces of placenta were excised and washed in PBS to remove excess blood. Tissue was then incubated in trypsin EDTA. After enzymatic digestion, a cell strainer was used to obtain a single cell suspension. The resulting cells were washed and centrifuged on
141
Lucrări Științifice – vol 53 seria Medicină Veterinară
PBS. Cells were then cultured in DMEM with 10% FCS, 1% antibiotics, 1%NEA (non essential amino acid) After 48 hours, non‐adherent cells were removed and the remaining cells cultured until almost confluent before passage. Media was changed every 3–4 days. After two or more passages, the cells were analysed.
Osteogenic differentiation was induced by two different culture medium: basal medium composed of DMEM (Gibco) supplimented with 10% FCS, 10‐7dexamethasone, 10mM β‐glicerophosphate, 1μg/ml insulin, 50μg/ml ascorbic acid, 10ng/ml BMP2, 2ng/ml TGFβ and specific medium for osteoblasts PromoCell Osteoblast Growth Medium.
To identify differentiated cells was performed immunohistochemical analysis of cell cultures at the end of the experiment. According to the immunohistochemical protocol, initial patency was achieved by treating cells for their intracellular antigens with a solution 0.1% TRITON X‐100 for 5 minutes and added lock patency 10% BSA solution. After 24 hours of keeping in contact, at 4°C were performed three successive washes with PBS solution and added primary antibodies: anti‐osteopontin (IgM) anti‐osteonectin (IgG2a).
RESULTS AND DISCUSSION
The cultures were observed daily by phase contrast invert microscopy to examine
adheretnt cell morphology. In the early days, individual adherent cells appeared in about 60% of the wells, 40% of the wells having no adherent cells. After examining cultures have identified two different types of cells, some were fibroblastic‐like and the others were round with dark centers and transparent peripheries. After 4 days some fibroblastic cells proliferated, giving rise to colonies of fibroblastic cells. At the end of day 8, generally 10‐12 fibroblastic colonies appeared. By the end of week 2 the number of floating cells increased within the culture medium (Fig.1). Passages was made at a 80% confluence to avoid contact inhibition. After each passages part of the cell suspension were frozen for future examination so as to investigate multilineage differentiation, proliferation potential and the presence of certain surface markers.
Figure 1 ‐ Microscopic analysis of cellular morphology 20x
142
Universitatea de Științe Agricole și Medicină Veterinară Iași
In osteoinductive cultures, a few cells became detached and floated in the medium during the culture period (Fig.2).
Figure 2 ‐ Cellular morphology after osteogenic induction and distinct cellular
colonies with osteogenic nodules
In some areas of the culture dish, nodule‐like structures of different sizes were observed. In cultures treated with basal medium after 8 days were observed emergence of cells with morphology similar to that of adipocytes namely cell cytoplasm filled with lipid droplets (Fig.3).
Figure 3 ‐ Apparition of adipocytes in culture 40x
Differentiation was further demonstrated by immunohistochemical staining for
osteopontine and osteocalcin. After 21 days induction period, the level of osteocalcin and osteopontine slightly increased (Fig.4). This marker did not express in the undifferentiated mesenchymal stem cells, but has been produced in the cells after the third week of induction.
143
Lucrări Științifice – vol 53 seria Medicină Veterinară
Figure 4 ‐ Immunohistochemical assay of osteopontin and
osteocalcin in cultures differentiated on osteogenic line 20x
After several passages the cells did not lose multipotential differentiation potential, fibroblastic morphology was maintained during the subculture period.
CONCLUSIONS
In the present investigation, pure fibroblastic cells with multilineage differentiation
capability were isolated from rat placenta. The isolation on placental cells is far more difficult than of other species due to the unwanted growth of non‐mesenchymal cells in both primary and passaged cultures. Certain features of the cells having been isolated via our approach convinced us that they were mesenchymal stem cells. The most important properties of these cells were their multilineage mesenchymal differentiation in culture medium and their ability to maintain this potential un to passage 8. BIBLIOGRAPHY
1. Mark F. P., Alastair M. M., Stephen C. B., Rama K. Jaiswal, Robin D., Joseph D. M., Mark A. M., Donald
W. S., Stewart C., Daniel R. M., 1999, Multilineage Potential of Adult Human Mesenchymal Stem Cells, Science,Vol. 284. no. 5411, pp. 143 – 147;
2. Mauro K., Massimo F., Giovanni P., Giuseppe A., 2007, Mesenchymal stem cells: from biology to clinical use, Blood Transfus, 5(3): 120–129.
3. Ppokratis Pountos, Peter V.Giannoudis, Biology of mesenchymal stem cells, Injury,Int.J.CareInjured (2005) 36S,S8—S12
4. Sarah Snykers, Tamara Vanhaecke, Vera Rogiers, 2006, Isolation of Rat Bone Marrow Stem Cells, Cytochrome P450 Protocols, Second Edition, Methods in Molecular Biology
5. Shengkun Sun, Zikuan G, Xuren X., Bing L., Xioaodan L., Pei‐Hsien Tang, Ning Mao, 2003, Isolation of mouse marrow mesenchymal progenitor by a novel and reliable method, Stem Cells, 21:527‐535
6. Yumi F., Hideaki N., Daisuke S., Imiko Hirose, Toshio K., Kohichiro T., 2004, Human Placenta‐Derived Cells Have Mesenchymal Stem/Progenitor Cell Potential, Volume 22 Issue 5, Pages 649 – 658;
7. Zongning M., Jun J., Lei C., Jianzhong Z., Wei H., Jidong Z., Hanguang Q., Xueguang Z., 2006, Isolation of mesenchymal stem cells from human placenta : Comparison with human bone marrow mesenchymal stem cells ‐ Cell biology international, vol. 30, no9, pp. 681‐687;
144
LUTEIN PREVENTS HIGH GLUCOSE INDUCED OXIDATIVE STRESS IN HUMAN RPE CELLS
Dumitrița RUGINA, Adela PINTEA, Andrea BUNEA, Raluca POP, Sanda ANDREI
University of Agricultural Sciences and Veterinary Medicine Cluj‐Napoca, Department of
Chemistry and Biochemistry, Mănăstur 3‐5 Cluj‐Napoca, 400372, Romania E‐mail: apintea@usamvcluj.ro
Abstract Human retina accumulates two dietary carotenoids: lutein and zeaxanthin. The
carotenoid pigments in retina act as screening pigments, by absorbing the damaging blue light, but it is supposed that they can also contribute to the antioxidant defence of retinal structures. Lutein was identified in several anatomic structures of the retina, including the retinal pigmented epithelium (RPE). The aim of this study was to investigate the effect of lutein on the oxidative status of RPE cultured cells in oxidative stress conditions induced by high glucose concentration in culture medium.
D407 RPE cells were cultivated in DMEM medium with 10 % FCS. The cells viability was estimated by the MTT assay and the cytotoxicity by LDH leakage assay. The generation of intracellular reactive oxygen species (ROS) was determined by using a fluorescent probe – DCF‐DA, TBAR’s by a fluorimetric method and reduced glutathione by an enzymatic assay. Antioxidant enzymes: glutathione peroxidase (GPx). Superoxide dismutase (SOD) and catalase activities were determined using commercial kits
High glucose concentration induced modification of oxidative stress markers: changes in antioxidant enzymes activity, increased lipid peroxidation and intracellular ROS generation. Lutein did not show any cytotoxic effect on RPE cells up to 10 μM in culture medium and protect them against induced oxidation. Lutein protects RPE cells by quenching the intracellular ROS generation, by reducing the lipid peroxidation and by enhancing the activity of superoxide dismutase and glutathione peroxidase. Addition of lutein did not significantly influenced reduced glutathione concentration and catalase activity. Increased concentration of lutein in RPE cells can contribute to antioxidant defence in oxidative stress conditions.
Keywords: Lutein, RPE cells, high glucose, oxidative stress INTRODUCTION The Retinal Pigment Epithelium (RPE) is a monolayer of cells representing the barrier
between the photoreceptors and the choriocapillaris. It provides oxygen and nutrients to the photoreceptors but also remove their debris and metabolites. The loss of RPE cells is related to several eye diseases, including age related macular degeneration (AMD). Retina and retinal pigment epithelium (RPE) represent an ideal environment for the generation of reactive oxygen species (ROS) and oxidative damages. There are three main sources of ROS generation in the RPE: high metabolic rate and oxygen consumption, high level of irradiation, phagocytosis of photoreceptors outer segments and the presence of photosensitizers (lipofuscin) (Miceli et al., 1994; Beatty et al., 2000; Winkler et al., 1999; Lu et al., 2006; Qin et al., 2007). The vision loss in AMD results from photoreceptor damages in the central retina,
145
Lucrări Științifice – vol 53 seria Medicină Veterinară
and it is accepted that degeneration of RPE is involved in first stages of AMD (Qin, 2007). It was demonstrated that oxidative stress plays an important role in the pathology of AMD (Kopitz et al., 2004; Qin, 2007; Coleman et al., 2008). Hyperglycemia which occurs in diabetes reduces the level of antioxidants and determines an increase of reactive oxygen species which, in turn produce oxidative damages in different tissues, including retina. RPE cells respond to acute high glucose level in culture medium by modification of antioxidant and proteolitic enzymes activity. Cultured RPE cells exposed to high glucose concentration showed elevated level of glutathione peroxidase, cathepsin B and heat shock protein 27, while the activity of Cu/Zn SOD was decreased compared to control (Yokoyama et al., 2006). High glucose concentration also determined a reduction of permeability in RPE cultured cells (Villarroel et al., 2009). Lutein and zeaxanthin are the only dietary carotenoids accumulating in the anatomic structures of human retina, including the retinal pigmented epithelium (RPE) (Khachik et al.,1997; Snodderly et al., 1984a). Xanthophylls act primarily as screening pigments in the retina by absorbing the damaging blue light but they can also contribute to the antioxidant defence of retinal structures (Beatty et al., 2000; Wrona et al., 2004; Krinsky and Johnson, 2005). Serum carotenoids, including xanthophylls lutein and zeaxanthin, are inversely associated with type II diabetes and impaired glucose metabolism (Coyne et al., 2005). In this context it is important to know how retinal cells respond to acute exposure to high concentrations of glucose, with or without addition of antioxidants.
The aim of this study was to investigate the effect of lutein on the oxidative status of RPE cultured cells in oxidative stress induced by high glucose concentration in culture medium.
MATERIAL AND METHODS
Cell culture and treatment. Human adult retinal pigment epithelial cells line D407 were maintained in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 100 U/ml penicillin, 100 μg/ml streptomycin, and 2.5 μg/ml amphotericin B, at 37◦C, 5% CO2, and 95% relative humidity. The cells were seeded in 25 cm3
flask at a concentration of 6 x 105. After reaching 90% confluence, growth medium was removed and replaced with medium containing 10 μM xanthophylls during 24 hours. Exposure of cells to high glucose concentration. During the first experiment cells were cultivated in increasing concentration of glucose in medium: 25 mM (control cells), 40 mM, 50 mM, 70 mM and 100 mM. After 24 h treatment with carotenoids, the culture medium was removed, the cells were washed and with PBS and specifically lysed for each enzyme determination. Viability assay. MTT assay was used to asses the cell viability (Mossman, 1983). This method uses the property of viable cells to reduce MTT reagent into a coloured formazan which is detected by reading the absorbance at 550 nm. Cell viability was expressed as a percentage of control (cells incubated in normal medium only). Antioxidant enzymes activity. Glutathione peroxidase (GPx), superoxide dismutase (SOD) and catalase (Cat) activities were determined using commercial kits provided by Cayman Chemical Company, Michigan, USA. The enzymes activity was expressed as IU/mg protein and the protein were determined with bicinchoninic acid assay (Sigma, St. Louis, USA). Glutathione assay. The GSH assay was performed using an optimized enzymatic recycling method with glutathione reductase (Cayman Chemical Company, Michigan, USA). Standard curve was made with GSSG standard, having the equivalent GSH concentration between 0‐16 μM. Results are expressed as μmoles GSH/mg protein in cell pellet. Intracellular reactive species assay. The determination of intracellular reactive oxygen species
146
Universitatea de Științe Agricole și Medicină Veterinară Iași
(ROS) is based on the oxidation of 2’,7’‐dichlorodihydrofluorescein (DCHF) by intracellular peroxides, forming the fluorescent compound 2’,7’‐dichlorofluorescein (DCF) (Lebel et al., 1992). TBAR’S concentration was determined after the reaction with thiobarbituric acid by using a calibration curve and a fluorimetric method. A micro plate reader HT BioTek Synergy (BioTek Instruments, USA) was used for all photometric and fluorimetric assays. Statistical analysis was done using One‐way analysis of variance ANOVA, Dunnett's Multiple Comparison Test of Graph Pad Prism version 5.00. Significant differences are designated by p<0.05 and notation ***extremely significant, **very significant, *significant. The points or bars represent the mean ± SD, calculated from three experimental values
RESULTS AND DISCUSSION D407 RPE cells are usually cultivated in medium containing 25 mM glucose, which
represents a high concentration. In the first part of this study we evaluated the influence of different higher glucose concentration in culture medium, mimicking hyperglycemia that occurs in diabetes, on the viability and intracellular reactive oxygen species generation (ROS). As can be observed in Fig. 1 (a) and (b), the increase of glucose concentration had positive effects on cells viability up to 70 mM but determined a decrease of viability at 100 mM glucose. Very high concentration of glucose (70 and 100 %) increased significantly the ROS generation, as can be seen from the time‐course increase of fluorescence. Glucose at 50 mM was chosen for the further experiments, based on the fact that it has positive effect on the cell viability but significantly increase the ROS generation compared with control.
25 m
M40
mM
50 m
M
70 m
M
100 m
M
0.0
0.1
0.2
0.3
0.4**
nsns
ns
Glucose concentration (mM)
Abs
orba
nce
(nm
)
0 35 70 105 140 175 210 2450
500
1000
1500
2000
250025 mM40 mM50 mM70 mM100 mM
Time (min)
DC
F fl
uore
scen
ce
(a) (b)
Fig.1. Viability of D407 cells treated with different concentration of glucose (a) and intracellular ROS generation (b). Statistic: one‐way ANOVA analysis of variance, Dunnet test, comparing all
columns with control column (25mM), p<0.05, **‐ very significant.
147
Lucrări Științifice – vol 53 seria Medicină Veterinară
Contro
lLUT
Contro
l gLUTg
0
50
100
150
LD
H c
itot
oxic
ity
(% fo
rm c
ontr
ol)
ns ns
Fig. 2. Lactate dehidrogenase leakage in D407 cells culture medium. Control; Control g – 50 μM glucose; LUT – Lutein 10 μM; LUT g – Lutein 10 μm + 50μM glucose
Control
LUT
Control-g
LUT g0
10
20
30
40
50 ***
**
Act
ivity
GPx
nm
ol/m
in/m
g pr
otei
n
Contro
lLUT
Contro
l-gLUTg
0
20
40
60
80
100
ns
ns
CA
T nm
oli/m
in/m
g pr
otei
n
(a) (b)
Fig. 3. Glutathione peroxidase (a) and catalase activity (b) in D407cells. Control; Control g – 50 μM glucose; LUT – Lutein 10 μM; LUT g – Lutein 10 μm + 50μM glucose
Statistic: one‐way ANOVA analysis of variance, Tukey test, p<0.05, *‐ significant, **‐ very significant, ***‐ extremely significant.
148
Universitatea de Științe Agricole și Medicină Veterinară Iași
In a previous study we demonstrated that cultured RPE cells are able to uptake lutein and zeaxanthin in the range of 1‐10 μM (Pintea et al., 2007). Lutein at 10 μM concentration did not affect the RPE cells viability in control or high glucose treated cells (data not shown) and did not show any cytotoxic effect in both experimental conditions (Fig. 2). Cells treatment with 50 mM glucose induced a small but not significant increase of GPx activity but a small decrease of catalase activity. Treatment with lutein for 24 h resulted in a very significant increase of GPx activity in both control and high glucose condition. Catalase activity was not significantly changed by addition of glucose or glucose and lutein (Fig. 3). It is known that catalase acts at high concentration of hydrogen peroxide while glutathione peroxidase acts at lower level of peroxides. High glucose concentration induced a small but not statistically significant decrease of SOD activity. The positive influence of lutein on SOD activity was more evident in control cells that in high glucose treated cells (Fig. 4a). Lutein in culture medium determined an inhibition of fluorescence in ROS assay, significant in the case of high glucose treated cells, demonstrating the ability of carotenoids to neutralize the intracellular reactive oxygen species (Fig. 4b). These results are correlated with a decrease of MDA concentration in cells treated with lutein at high glucose concentration (Table 1). Reduced glutathione concentration was lower in high glucose treated cells that in control cells but there were not significant changes after addition of lutein, both in normal and high glucose samples (Table 4). Similar results were obtained were xanthophylls (lutein, zeaxanthin and β‐cryptoxanthin) were tested in oxidative stress induced by addition of hydrogen peroxide in culture medium (Pintea et al, unpublished data).
Contro
lLUT
Contro
l gLUTg
0
5
10
15
20
*
ns
SOD
U/ m
g pr
otei
n
Control
LUT
Control-g
LUT g0
200
400
600
800
1000
1200
1400
DC
F fl
uore
scen
ce
ns *
(a) (b)
Fig. 4. Superoxide dismutase activity (a) and ROS generation in D407 cells. Control; Control g – 50 μM glucose; LUT – Lutein 10 μM; LUT g – Lutein 10 μm + 50μM glucose;
Statistic: one‐way ANOVA analysis of variance, Tukey test, p<0.05, *‐ significant, **‐ very significant, ***‐ extremely significant.
Table 1. Lipid peroxidation (TBAR’S) and reduced glutathione (GSH)
Control Lutein High glucose Lutein high glucose
TBAR’S (nmol/mg protein)
0.63 ± 0.09 0.61 ± 0.07 0.76 ± 0.12 0.71 ± 0.07
GSH (nmol/mg protein)
21.2 ± 3.4 21.5 ± 3.0 18.4 ± 2.4 19.4 ± 2.9
Values are mean ± standard deviation
149
Lucrări Științifice – vol 53 seria Medicină Veterinară
Diabetes is a chronic metabolic disorder manifested by a complex symptomatology.
Oxidative damages have been reported to be involved in the pathogenesis of diabetes and of other neurodegenerative diseases. Hyperglycemia which occurs in diabetes reduces the level of antioxidants and determines an increase of reactive oxygen species which, in turn produce oxidative damages in different tissues, including retina. One of the complications of diabetes is diabetic retinopathy, caused by inefficient control of blood glucose levels. Manifestations of diabetic retinopathy occur when the retina is exposed to prolonged high glucose level. Diabetic retinopathy affects virtually all subjects who suffer from type I diabetes by at least 20 years and 80% of those with type II diabetes for the same period. Most of the effects of high glucose concentration are actually related to increased metabolism. Thus, there is an increase in glycolysis, in pyruvate production, and in oxidative phosphorylation. Oxidative phosphorylation is one of the physiological processes that generate reactive oxygen species. Furthermore, reactive oxygen species are also produced outside mitochondria, in part by sorbitol oxidation. It is also considered that oxidative degradation of proteins contributes to damage of blood vessels, involved in the pathogenesis of diabetic microangiopathy (Yokoyama et al., 2006). Several in vivo studies showed that progression of diabetic retinopathy is inhibited by the use of antioxidants, by lowering the level of lipid peroxidation, of oxidatively modified DNA, nitrotyrosine and other markers of oxidative stress (Martin‐Gallan, P., et al., 2005, Kowluru, RE et al., 2008). However, zeaxanthin did not prevent the decrease in GSH content in the retina of diabetic rats (Kowluru et al., 2008). Lutein treatment of healthy and diabetic mice prevented the oxidative stress induced changes on the lipid peroxidation and GPx activity in retina and hippocampus (Muriach et al., 2006). Lutein was recently reported to prevent cortex lipid peroxidation in streptozotocin‐induced diabetic rats (Arnal et al., 2010). Administration of high concentrations of glucose in the culture medium of RPE cells (33mm) led to an increase of cathepsin‐B expression, glutathione peroxidase and heat shock protein 27. For Cu/ZnSOD the isoelectric point shifted toward acidic region in response to high glucose concentration. Unlike for other enzymes, SOD activity was lower compared with control cells. The authors concluded that RPE cells respond to acute pathologically high glucose by elevated expression of antioxidant enzymes (GPX, Hsp27) and proteolytic enzymes (Yokoyama et al., 2006). Cells respond differently to elevated glucose concentrations. Cultured human Schwann cells exposed to high glucose showed an increase in superoxide dismutase and catalase activity, but a decrease in reduced glutathione concentration (Askwith et al., 2009). CONCLUSIONS
We examined the effect of high doses of glucose on the viability and oxidative status of cultured retinal pigment epithelial cells and the effect of lutein addition on the antioxidant status of cells cultivated in normal and high glucose medium.
Lutein did not show any cytotoxic effect on RPE cells up to 10 μM in culture medium and protect them against induced oxidation. Lutein protects RPE cells by quenching the intracellular ROS generation, by reducing the lipid peroxidation and by enhancing the activity of superoxide dismutase and glutathione peroxidase. Addition of lutein did not significantly influenced reduced glutathione concentration and catalase activity. Increased concentration of lutein in RPE cells can contribute to antioxidant defence in oxidative stress conditions.
Acknowledgements This work was supported by CNCSIS–UEFISCSU, PNII – IDEI code ID_854, 414/2007. We gratefully acknowledge to Prof. Dr. Horst A. Diehl for providing the D407 RPE cells.
150
Universitatea de Științe Agricole și Medicină Veterinară Iași
REFERENCES
1. Arnal, E., Miranda, M., Barcia, J., Bosch‐Morell, F., Romero, F.J., Lutein and docosahexaenoic acid prevent cortex lipid peroxidation in streptozotocin‐induced diabetic rat cerebral cortex, Neuroscience, 2010, 166, 271‐278
2. Asckwith, T., Zeng, W., Eggo, MC, Stevens, MJ, Oxidative stress and dysregulation of the taurine transporter in high‐glucose‐exposed human Schwann cells: implications for pathogenesis of diabetic neuropathy, Am J Physiol Endocrinol Metab, 2009, 297(3), 620‐628
3. Beatty S., Koh H.H., Phil M., Henson D., Boulton M., The role of oxidative stress in the pathogenesis of age‐related macular degeneration, Survey of Ophtalmology, 2000, 45, 115‐134
4. Coleman, H. R., Chan, C. C., Ferris, F. L., 3rd and Chew, E. Y., Age‐related macular degeneration, 2008, Lancet, 372(9652): 1835‐1845
5. Khachik F., Bernstein P.S., Garland D.L., Identification of lutein and zeaxanthin oxidation products in human and monkey retinas, Invest Ophthalmol Vis Sci., 1997, 38(9),1802‐1811.
6. Kopitz, J., Holz, F.G., Kaemmerer, E., Schutt, F., Lipids and lipid peroxidation products in the pathogenesis of age‐related macular degeneration, Biochimie, 2004, 86, 825‐831
7. Kowluru, R.A., Menon, B., Gierhart, D.L., Beneficial Effect of Zeaxanthin on Retinal Metabolic Abnormalities in Diabetic Rats, Invest Ophthalmol Vis Sci., 2008, 49, 1645‐1651
8. Krinsky, N.I., Johnson, E.J., Carotenoid actions and their relation to health and disease, Molec. Asp. Medicine, 2005, 26, 459‐516
9. LeBel C.P., Ischiropoulos, H., Bondy, S.C., Evaluation of the probe 2',7'‐dichloro‐fluorescin as an indicator of reactive oxygen species formation and oxidative stress, Chem Res Toxicol, 1992, 5 (2), 227‐231
10. Lu L., Hacket S.F., Mincey, A., Lai H., Capochiaro P.A., Effects of different types of oxidative stress in RPE cells, J. Cell Physiol., 2006, 206 (1), 119‐125
11. Martın‐Gallan, P., Carrascosa, A., Gussinye, M., Domınguez, C., Estimation of lipoperoxidative damage and antioxidant status in diabetic children: relationship with individual antioxidants, 2005, Free Radic. Res., 39, 933‐942
12. Miceli M.V., Liles M.R., Newsome, D.A., Evaluation of oxidative processes in human pigment epithelial cells associated with retinal outer segment phagocytosis, Exp Cell Res, 1994, 214 (1): 242‐249
13. Mosmann T., Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays, J Immunol Methods, 1983, 65 (1‐2), 55‐63
14. Muriach, M., Bosch‐Morell, F., Alexander, G., Blomhoff, G., Barcia, J., Arnal, E., Almansa, I., Romero, F.J., Miranda, M., Lutein effect on retina and hippocampus of diabetic mice, Free Radical Biology & Medicine, 2006, 41, 979‐984
15. Pintea Adela, Dumitrița Preda, Cornelia Braicu, Andrea Bunea, Carmen Socaciu, H.A. Diehl, Lutein and Zeaxanthin uptake in cultured retinal pigmented epithelial cells, Bulletin USAMV Cluj Napoca series MV, 2007, 64(1‐2), 238‐243
16. Qin, S., Oxidative damage of retinal pigment epithelial cells and age‐related macular degeneration, Drug Dev Res, 2007, 68, 213‐225
17. Snodderly D.M., Brown P.K., Delori F.C., Auran J.D., The macular pigment. I. Absorbance spectra, localization and discrimination from other yellow pigments in
151
Lucrări Științifice – vol 53 seria Medicină Veterinară
primate retinas. Invest. Ophtalmol. Vis. Sci., 1984a, 25, 660‐673 18. Villarroel, M., Garcia‐Ramirez, M., Corraliza, L., Hernandez, C., Simo, R., Effects of high
glucose concentration on the barrier function and the expression of tight junction proteins in human retinal pigment epithelial cells, Exp. Eye Res., 2009, 89, 913‐920
19. Winkler, B.S., Boulton, M.E., Gottsch, J.D., Sternberg, P., Oxidative damage and age‐related macular degeneration, Mol Vis, 1999, 5: 32
20. Wrona, M., Rozanowska, M., Sarna, T., Zeaxanthin in combination with ascorbic acid or alpha‐tocopherol protects ARPE‐19 cells against photosensitized peroxidation of lipids, Free Radic. Biol. Med., 2004, 36, 1094‐1101
21. Yokoyama, T., Yamane, K., Minamoto, A., Tsukamoto, H., Yamashita, H., Izumi, S., Hoppe, G., Sears, J.E., Mishima, H.K., High glucose concentration induces elevated expression of anti‐oxidant and proteolytic enzymes in cultured human retinal pigment epithelial cells, Exp. Eye Res., 2006, 83, 602‐609
152
ALUMINIUM SULPHATE IMPACT ON FUNDAMENTAL
BIOMARKERS OF REPRODUCTIVE FUNCTIONALITY IN FEMALE RATS (SUCKLING PERIOD EXPOSURE)
TRIF ALEXANDRA1, DUMITRESCU EUGENIA 1, PETROVICI SNEJANA1
Corresponding author: Alexandra Trif, Banat’s University of Agricultural Sciences and Veterinary Medicine, Faculty of Veterinary Medicine, Calea Aradului, 119, 300645 Timisoara,
Romania, tel.0040256277076, e‐mai:al_trif@yahoo.coml
Recent researches are emphasizing more and more obvious the perturbance of the health of the reproductive process, the causes including substances with toxic potential (industrial contaminants, pesticides, organic solvents, etc.) (3). The studies in the field of reproductive toxicology are of opportunity because in Romania there is primary and secondary aluminium industry, that represents a real risk for the environment, animals and humans health (2). The aim of the study was the evaluation of aluminium toxic impact on the femele reproductive system integrity, functionality and performances biomarkers. The objectives of the study were evaluation of the reproductive functionality fundamental biomarkers (duration of sexual cycle and sexual cycle regularity) at sexual maturity of female offspring exposed to aluminium sulphate only during suckling period.
Key words: aluminium rats, sexual cycles.
MATERIAL AND METHODS The study was carried out on 32 adult female rats (90 days) exposed to aluminium
sulphate during suckling period as follows: E1: 200 ppb Al (the exceptional admitted limit in drinking water according to the Law 485/2002); E2: 400 ppb Al; E3: 1000 ppb Al (values representing concentrations found out in water sources destinated for animals and, sometimes, for people, in areas exposed to the risk of aluminium based industrial contamination).
The exposure to aluminium sulphate was stopped from weaning until sexual maturity. Control group received tap water.
The forages and water have been assured ad libitum. Duration of sexual cycle and of sexual cycle stages regularity were appreciated by
examination of vaginal smear cytological characteristics (stained May‐Grunnwald‐Giemsa method, examinated by optic microscope. X 20).
The results had been processed by ANOVA method and Student test. All assays with animals were conduced in accordance with present laws regarding
animal welfare and ethics in animal experiments (5, 6, 7, 8, 9, 10).
153
Lucrări Științifice – vol 53 seria Medicină Veterinară
RESULTS AND DISSCUSIONS The results are presented in table 1, 2, and figures 1, 2.
Table 1. Mean sexual cycle duration (days)
Fig.1. Dynamics of sexual cycle duration (days)
In C group, sexual cycle was in physiological limits – 4‐5 days (4), but in exposed
groups, the duration was significantly (p<0.01) higher than the physiological limits, directly correlated with the exposure level: E1/C: +14.72%; E2/C: +21.88%; E3/C: +25.56; E2/E1: +6.23%, p<0.05; E3/E2: +3.02%, p>0.05; E3/E1:+9.44%, p<0.01
In C group all sexual cycle stages ranged in physiological limits as duration. Percentage of proestrus in physiological limits was significantly (p<0.01) lower
comparative to C group: E1/C: ‐1.89%, p<0.05; E2/C:‐5.24%, p<0.01; E3/C: ‐6.12%, p<0.01, and inversely correlated with the exposure level (E2/E1: ‐3.41%, p<0.01; E3/E2: ‐0.92%, p>0.05; E3/E1:‐4.3%, p<0.01).
No sexual cyles with absent proestrus were reported. Exposure to aluminium determined the appearance of sexual cycles with prolonged
proestrus, increasing significantly (p<0.01), in direct correlation with the exposure level: E1/C: +93%; E2/C:+257%; E3/C: +300%; E2/E1: +84.97%, p<0.01; E3/E2: ‐12.04%, p>0.05; E3/E1:+107.25, p<0.01%.
The percent of sexual cycles with estrus in physiological limits was in E group significantly (p<0.01) lower than in C group. inversely. significantly (p<0.01) correlated with the exposure level: E1/C: ‐5.57%; E2/C:‐10%; E3/C: ‐11.43%; E2/E1: ‐4.69%, p>0.05; E3/E2: ‐1.58%, p>0.05; E3/E1:‐6.20, p<0.01%.
Exposure to aluminium determined the appearance of sexual cycles with absent estrus in E groups: E1/C: 5.57%/0%; E2/C:10%/0%; E3/C: 11.43%/0%; increasing significantly,
Group
X±Sx D.S. C.L. 95%
C 4.89±0.09 0.23 0.21 E1 5.61±0.12 0.32 0.21 E2 5.96±0.08 0.22 0.21 E3 6.14±0.12 0.31 0.21
154
Universitatea de Științe Agricole și Medicină Veterinară Iași
in direct correlation with the exposure level E2/E1: +79.53%, p<0.01; E3/E2: +14.3%, p<0.05; E3/E1:+105.2%, p<0.01.
The percent of sexual cycles with diestrus I in physiological limits significantly decreased (p<0.01) in exposed groups comparative to C group: E1/C: ‐4%; E2/C:‐10.54%; E3/C: ‐13.43%, inverselly, significantly (p<0.01) correlated with the exposure level: E2/E1: ‐6.84%, p<0.01; E3/E2: ‐3.19%, p<0.05; E3/E1: ‐9.82%, p<0.01).
No sexual cyles with absent diestrus I were reported. Exposure to aluminium determined the appearance of sexual cycles with
prolonged diestrus I, increasing significantly (p<0.01), in direct correlation with the exposure level: E1/C: 4%/0%; E2/C:10.57%/0%; E3/C: 13.43%/0%; E2/E1: +164.25%; E3/E2: +27.05%; E3/E1:+235.75%.
The percent of sexual cycles with diestrus II in physiological limits significantly decreased (p<0.01) in exposed groups, comparative to C group: E1/C: ‐6.71%; E2/C:‐11%; E3/C: ‐14.14%, inverselly, significantly (p<0.01) correlated with the exposure level E2/E1: ‐4.59%; E3/E2: ‐3.52%; E3/E1:‐7.96%.
No sexual cyles with absent diestrus II were reported. The precent of sexual cycles with prolonged diestrus II was significantly (p<0.01)
higher in E groups than in C group: E1/C: 6.71%/0%; E2/C:11%/0%; E3/C: 14.14%/0%; directly, significantly (p<0.01) correlated with exposure level: E2/E1: +63.93%; E3/E2: +28.54%; E3/E1:+110.73%.
Figure. 2. Sexual cycle stages dynamics
Appearance of anormal sexuale cycles was mentioned by Agrawald et al., (1) consecutive female exposure from in utero period until sexual maturity.
No data regarding the influence of exposure period, and/ or duration (month, generations) on sexuale cycle characteristics were found.
155
Lucrări Științifice – vol 53 seria Medicină Veterinară
Table 2. Sexual cycle stages (% of total sexual cycles)
N – physiological (as duration) stage A‐ absent stage
P – prolonged stage E1 – 200 ppb Al E2 – 400 ppb Al E3 – 1000 ppb Al
NB: 28 supervised sexual cycles /group (7 individuals/group x 4 supervised sexual cycles)
Sexual cycle stage
C E1 E2 E3
Proestrus N X ± Sx 98± 0.44 96.14±0.51 92.86±0.63 92.00±0.44S. D. 1.15 1.35 1.68 1.63C.L: 0.76 0.76 0.76 0.76
A X ± Sx 0.00± 0.00 0.00±0.00 0.00±0.00 0.00±0.00S. D. 0.00 0.00 0.00 0.00C.L: 0.76 0.76 0.76 0.76
P X ± Sx 2.00± 0.44 3.86±0.01 7.14±0.26 8.00±0.49S. D. 1.15 0.01 0.69 1.29C.L: 0.76 0.76 0.76 0.76
Estrus N X ± Sx 100± 0.00 94.43±1.57 90.00±0.79 88.57±0.87S. D. 0.00 4.16 2.08 2.30C.L: 1.18 1.18 1.18 1.18
A X ± Sx 0.00± 0.00 5.57±0.13 10.00±0.44 11.43±0.37S. D. 0.00 0.13 1.15 0.98C.L 1.18 1.18 1.18 1.18
P X ± Sx 0.00± 0.00 0.00±0.00 0.00±0.00 0.00±0.00S.D. 0.00 0.00 0.00 0.00C.L 1.18 1.18 1.18 1.18
Diestrus I N X ± Sx 100± 0.00 96.00±0.53 89.43±1.11 86.57±0.53S.D. 0.00 1.41 2.94 1.40C.L: 0.89 0.89 0.89 0.89
A X ± Sx 0.00± 0.00 0.00±0.00 0.00±0.00 0.00±0.00S.D. 0.00 0.00 0.00 0.00C.L: 0.89 0.89 0.89 0.89
P X ± Sx 0.00± 0.00 4.00±0.49 10.57±0.37 13.43±0.48S.D. 0.00 1.29 0.98 1.27C.L: 0.89 0.89 0.89 0.89
Diestrus II N X ± Sx 100± 0.00 93.29±0.68 89.00±0.31 85.86±0.40
S.D. 0.00 1.80 0.82 1.07
C.L: 0.93 0.67 0.67 0.67
A X ± Sx 0.00± 0.00 0.00±0.00 0.00±0.00 0.00±0.00
S.D. 0.00 0.00 0.00 0.00
C.L: 0.93 0.67 0.67 0.67
P X ± Sx 0.00±0.00 6.71±0.42 11.00±0.53 14.14±0.40
S.D. 0.00 1.11 1.41 1.07
C.L: 0.93 0.67 0.67 0.67
156
Universitatea de Științe Agricole și Medicină Veterinară Iași
CONCLUSIONS
Exposure to aluminium sulphate during suckling period determined in female rats at sexual maturity:
Significant increase of sexual cycle duration comparative to control group, over the physiological limits, and in direct correlation to exposure level;
Modification of sexual stages regularity: o significant decrease of sexual cycles percentage with proestrus, estrus, diestrus I
and diestrus II in physiological limits as duration comparative to control group and inversely correlated with the exposure level;
o appearance of sexual cycles with absent estrus, directly correlated with the exposure level;
o appearance of sexual cycles with prolonged proestrus, diestrus I and II, directly, significantly correlated with exposure level.
REFERENCES
1. Agarwal, S.K., Ayyash, L., Gourlet, C.S., Levy, L., Faber, K., Hughes, C.L.JR.
Evaluation of the developmental neuroendocrine and reproductive toxicology of aluminium. Food Chem Toxicol. 1996, 34:1: 49‐53.
2. Drugă Mărioara Aluminiul. Potențialul poluant al industriei de prelucrare primară şi secundară. Impactul asupra organismelor vii, Teză de doctorat,2005, USAMVB Timişoara.
3. Gupta C. Ramesh., Veterinary Toxicology, 2007, Ed. Academic Press U.S.A. 4. Kei‐Ichiro Maeda., Satoshi Ohkura., Hiroko Tsukamura., Physiology of
Reproduction, Academic Press, Japan, 2000, pp. 145‐456; 5. ***Directiva 86/609 Din 24.11.1986 privind protecția animalelor utilizate în
scopuri experimentale și în alte scopuri științifice, http://ec.europa.eu/food/fs/aw/aw_legislation/scientific/86‐609‐eec_en.pdf;
6. ***Legea 205/26.05.2004 privind protecția animalelor, M. O. nr. 531/14.06.2004;
7. ***Legea 206/27.05.2004 privind buna conduită în cercetarea științifică, dezvoltarea tehnologică și inovare, M. O. nr. 505/4.06.2004;
8. ***Legea 471/9.07.2002 privind aprobarea O.G. nr. 37/2002 pentru protecția animalelor folosite în scopuri științifice sau în alte scopuri experimentale, M. O. nr. 535/23.07.2002;
9. ***Legea 9/11.01.2008 pentru modificarea și completarea Legii nr. 205/2004 privind protecția animalelor, M. O. nr. 29/15.01.2008;
10. ***Ordin 143/400 pentru aprobarea instrucțiunilor privind adăpostirea și îngrijirea animalelor folosite în scopuri științifice sau în alte scopuri experimentale, M. O. nr. 697/24.09.2002;
157
IMPROVEMENT OF GLUCOSE CONCENTRATION, LIPOPROTEIN
PROFILE AND ANTIOXIDANT BIOMARKERS IN BLOOD OF NATURALLY DIABETIC BITCHES ADMINISTERED INSULIN WITH
VITAMIN C OR VITAMIN E
Wael M. EL‐Deeb a , S.M. El ‐Bahrb
a(Corresponding author) Department of clinical studies, College of Veterinary Medicine and animal Resources, King
Faisal University, Saudi Arabia, Al‐Ahsa, 31982 P.O. Box: 1757
e‐mail: drwaeleldeeb@yahoo.com b
Department of Physiology, Biochemistry and Pharmacology, College of Veterinary Medicine and animal Resources, King Faisal University, Saudi Arabia, Al‐Ahsa, 31982
Abstract The present work aimed to determine if vitamin C or E has any advantage over insulin therapy on glucose concentration, lipoprotein profile, antioxidant activity and lipid peroxidation in naturally diabetic bitches. Therefore, forty bitches were divided into four groups (10 bitches in each). The first and second groups were served as non diabetic and diabetic control group, respectively. Dogs of group 2 were divided to 3 groups (10 animals each) and subjected to different three treatment protocols namely group 3, 4 and 5 which treated with insulin, insulin and ascorbic acid, and insulin and vitamin E, respectively. Values of blood glucose, serum total cholesterol, low density lipoprotein cholesterol (LDL‐c) and high density lipoprotein cholesterol (HDL‐c) were determined. In addition, the enzymatic activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX) and the values of malondialdehyde (MDA) were measured in erythrocyte hemolysate as biomarkers of antioxidation. Results revealed that, in diabetic bitches, the values of glucose, total cholesterol, LDL‐c and MDA were significantly increased as compared to non diabetic bitches. SOD, CAT, and GPX activities and HDL‐c values of diabetic bitches were significantly decreased as compared to normal bitches. In diabetic bitches, supplementation of examined dose of vitamin C or vitamin E with insulin was effective in inhibiting hyperglycaemia, hypercholesterolemia, oxidative stress and lipid peroxidation than insulin alone. These effects were almost the same whatever the vitamin used.
Keywords: Diabetes mellitus, lipoproteins, oxidative stress, vitamin C, vitamin E, bitches
1. INTRODUCTION
Diabetes mellitus (DM) is the most common metabolic disease. It is more likely that long‐term, uncontrolled DM with sustained high blood glucose levels is the cause of glucose autooxidation with increased oxidative stress (So¨zmen et al., 2005). Overproduction of reactive oxygen species (ROS) through the electron transport chain has been demonstrated in DM. Lipid peroxidation is an important biological consequence of oxidative cellular damage in patients with DM. Serum lipoperoxidation products such as malondialdehyde (MDA) reflects oxidative stress.
158
Lucrări Științifice – vol 53 seria Medicină Veterinară
The increase in ROS causes nonspecific modification of nucleic acids, proteins, and
phospholipids leading to DNA, RNA, and protein damage and alterations in antioxidant enzyme levels. All these events result in cellular and tissue damage. Tissue damage induced by free radicals is thought to be an important factor in the pathogenesis of DM and its complications (Annunziata et al., 2005). Experimentally, streptozotocin (STZ) induces DM, probably through the generation of ROS, leading to islet cell destruction (Tavridou et al., 1997). Living organisms possess antioxidant defense systems against ROS. These defense systems include endogen antioxidants, which can be classified as enzymatic (SOD, GSH) and nonenzymatic (vitamin E, vitamin C, uric acid, bilirubin) defense system. Once ROS formed, it depletes antioxidant defense systems, rendering the affected cells and tissues more susceptible to oxidative damage.
Dogs are becoming an important medical research model because it shares the same environment as humans and develops many of similar chronic diseases (Kearns et al., 1999, and Adams et al., 2000). Much of their biochemical and endocrine mechanisms are similar to humans (Kararli, 1995, and Felsburg, 2002). DM is one of the most frequently diagnosed endocrinopathies in cats and dogs. Type 1 diabetes mellitus (insulin dependent diabetes) is most common in dogs (Expert Committee on the Diagnosis and Classification of Diabetes Mellitus, 1997). At present, there are no internationally accepted criteria for the classification of canine diabetes. No laboratory test is readily available to identify the underlying cause of diabetes in dogs, and diagnosis is generally made late in the disease course. If the criteria established for human diabetes are applied to dogs, at least 50% of diabetic dogs would be classified as type 1, because this proportion has been shown to have antibodies against β‐cells (Hoenig and Dawe, 1992; Davison et al., 2003).
The balance between oxidant and antioxidant species has been proposed to have an important role in preventing diabetic complications. Dietary antioxidants play a major role in the maintenance of the oxidative balance. Vitamin C, vitamin E, and other micronutrients protect humans DM (Schwedhelm et al., 2003). Numerous studies have demonstrated that antioxidant vitamins and supplements can help lower the markers indicative of oxidant stress and lipid peroxidation in diabetic subjects and animals. A number of studies have reported vitamin C, vitamin E and beta‐carotene deficiency in diabetic patients and experimental animals (Penckofer, et al., 2002; Naziroglu and Butterworth 2005).
To our knowledge, up till now, the publications concerning the effect of insulin combined with vitamin C or E in diabetic bitches are not available. Therefore, the present study aimed to determine the effect of combined administration of insulin with vitamin C or vitamin E on glucose concentration, lipoproteins profile and oxidative stress markers in naturally diabetic bitches.
2. MATERIALS AND METHODS
2.1. Animals A total of 40 bitches (5‐8 years old) were used in the present study. They were
maintained as performed by national guidelines and protocols, approved by the University Animal Ethics Committee. They were divided into four groups. Bitches of the first group (10 animals) were non diabetic and served as a control non diabetic group (positive control; group 1). Bitches of the second group (30 animals) were diagnosed as diabetic and served as control diabetic group (negative control; group II). This group (group 2) was divided to 3 groups (10 animals each) and subjected to different three treatment protocols. For simple presentation these groups were named group 3, 4 and 5. Bitches of the third group were
159
Universitatea de Științe Agricole și Medicină Veterinară Iași
treated with insulin in a dose rate of 0.5 unite/kg body weight twice daily. Bitches of the fourth group were treated with insulin in a dose rate of 0.5 unite/kg body weight twice daily, and ascorbic acid supplementation in a dose rate of 30 mg/kg body weight and once daily (Morgan, 2008). Bitches of the fifth group were treated with insulin in a dose rate of 0.5 unit/kg body weight and vitamin E supplementation in a dose rate 800 IU once daily (Morgan, 2008). The insulin dose was stabilized over the time of the experiment. All experimental groups were presented in Figure 1.
2.2. Sampling protocol Fasting blood sample was collected one month post treatment from the cephalic vein
from all groups in fresh heparinized vials containing sodium fluoride for the estimation of glucose. Some blood samples were used for preparation of serum for determination of total cholesterol, LDL‐c and HDL‐c. In addition, the activities of super oxide dismutase (SOD), Catalase (CAT), Glutathion peroxidase (Gpx) and Malondialdehyde (MDA) in erythrocyte hemolysate were also determined.
From ethical point of view, samples were taken from 10 animals of the group II and served as a diabetic control samples. Afterwards all group II as mentioned before were treated by different examined drugs. This has been done to run the experiment without depriving any dogs of treatment.
2.3. Preparation of hemolysate After collecting blood samples in heparinized tubes, centrifugation was performed at
1000g for 15 min to remove the buffy coat. The packed cells obtained at the bottom were washed thrice with phosphate buffer saline (0.9% NaCl in 0.01 M phosphate buffer, pH 7.4). Erythrocytes were lysed with hypotonic phosphate buffer. The hemolysate was obtained after removing the cell debris by centrifugation at 3000g for 15 min and used for determination of super oxide dismutase (SOD), Catalase (CAT), Glutathion peroxidase (Gpx) and Malondialdehyde (MDA).
2.4. Determination of glucose and lipoprotein profile Blood glucose was estimated by the method of Dubowski as modified by Sasaki et al.,
(1972). Blood was treated with 10% trichloroacetic acid, mixed and centrifuged at 1000g for 10 min; the protein free supernatant was then treated with orthotoludine reagent and kept in a boiling water bath for 10 min. The color developed was read using spectrophotometer at an absorbance of 640 nm. Enzymatic method of spinreact kits was used for colorimetric determination of serum total cholesterol (Zak et al., 1954) according to the manufacturer instructions. Briefly, the spectrophotometer was adjusted to zero by distilled water. Afterwards, in clean and dry separate test tubes, 10μl of serum and standard of cholesterol were added to 1ml of their working solutions. However, the blank was prepared by adding 1 ml of the working solution in a separate tube. After mixing, the mixture was incubated for 5 minutes at 37 °C and the developed colour was measured colorimetrically against blank at wave length of 505 nm. The value of cholesterol (mg/dl) were calculated by dividing the value of the absorbance of the serum sample on that of the standard and the resultant value then multiplied by 200 (Standard concentration). Detection limit was ranged from 0.6 to 600 mg/dl. However, the sensitivity was 1 mg/dl. Enzymatic method of spinreact kit was used also for colorimetric determination of serum HDL‐c (Lopes‐Virella et al., 1977). Briefly, 1 ml of the serum was added to 100 μl of the precipitating reagent. After mixing, the mixture allowed to stand for 10 minutes at room temperature. After centrifugation (3000g/20 minutes), the supernatant was collected and the cholesterol value was estimated as mentioned above.
160
Lucrări Științifice – vol 53 seria Medicină Veterinară
Detection limit was ranged from 1.57 to 275 mg/dl and the sensitivity was 1 mg/dl. VLDL‐c was calculated by division of TAG/5 mg/dl while the LDL‐c was calculated as total cholesterol – (HDL‐c + VLDL‐c) = mg/dl (Bauer, 1982).
2.5. Determination of Antioxidant enzymes Activity of superoxide dismutase SOD (inhibition rate percent) was assayed in the RBC's
cell as described by Nishikimi et al. (1972) using commercial available kits (Bio‐diagnostic, Kit number SD2520). The activity of catalase was assayed in the RBC's cell by the method of Aebi, (1984) using commercial available kits (Bio‐diagnostic, Kit number CA2516). The activity of the enzyme was expressed as units/mg of haemoglobin. Glutathione peroxidase (GPx) (EC.1.l1.1.l9) was assayed by the method of Rotruck et al. (1973). The hemolysate were prepared in Tris‐HCl buffer (pH 7.0, 0.4 M). The assay mixture contained EDTA, sodium azide (10 mM), reduced glutathione (GSH 0.2 mM), and H2O2 (0.2 mM) and the appropriately diluted enzyme preparation. A system devoid of enzyme served as the control. The activity was determined by measuring the amount of GSH consumed after carrying out the reaction for 10 minutes.
2.6. Determination of lipid peroxidation Lipid peroxidation was assayed by the measurement of MDA levels on the base of
MDA reacted with thiobarbituric acid at 532 nm, according to Ohkawa et al. (1979) using commercially supplied kits (Bio‐diagnostic, Kit number MD2529).
2.7. Statistical analysis The obtained data of biochemical parameters were compared between groups within
different concentrations by using computer package of the statistical analysis system (SAS, 1997). All data are presented as means ± standard deviation (SD).
3. RESULTS
The data summarized in Table 1 showed the level of blood glucose, total cholesterol,
LDL‐c and HDL‐c in the control and experimental Bitches. Blood glucose level in insulin treated bitches (Groups 3) was significantly increased than the normal value noted in the control bitches whereas its concentration in insulin‐vitamin C and insulin‐vitamin E treated bitches (Groups 4 and 5 respectively) were comparable to the control group. However, blood glucose level in diabetic bitches (Group 2) was significantly (p < 0.01) higher than control and treated groups. Administration of insulin, insulin with vitamin C and insulin with vitamin E to diabetic bitches decreased blood glucose level significantly compared to the diabetic animals not getting either compound. Administration of insulin with vitamins (C or E) was found to be more effective in lowering blood glucose level than insulin administered alone.
Serum total cholesterol values in insulin, insulin‐vitamin C and insulin‐vitamin E (Groups 3, 4 and 5 respectively) treated bitches were significantly increased than the normal values noted in the control bitches whereas its concentration in diabetic bitches (Group 2) was significantly (p < 0.01) higher than control and treated groups. Administration of insulin, insulin with vitamin C and insulin with vitamin E to diabetic bitches decreased the levels of total cholesterol concentrations significantly compared to the diabetic animals not getting either compound. Administration of insulin with vitamin C was found to be more effective in lowering total cholesterol value followed by administration of insulin with vitamin E and finally insulin administered alone.
161
Universitatea de Științe Agricole și Medicină Veterinară Iași
LDL‐c level in insulin treated bitches (Groups 3) was significantly increased than the
normal value noted in the control bitches whereas its concentration in insulin‐vitamin C and insulin‐vitamin E treated bitches (Groups 4 and 5 respectively) were comparable to the control group. However, LDL‐c level in diabetic bitches (Group 2) was significantly (p < 0.01) higher than control and treated groups. Administration of insulin, insulin with vitamin C and insulin with vitamin E to diabetic bitches decreased LDL‐c level significantly compared to the diabetic animals not getting either compound. Administration of insulin with vitamins (C or E) was found to be more effective in lowering LDL‐c level than insulin administered alone.
The concentration of serum HDL‐c in bitches treated with insulin (Groups 3) was significantly (p < 0.01) lower than that of the control bitches whereas the concentration in insulin‐vitamin C and insulin‐vitamin E treated bitches were comparable with the control group. The concentration of serum HDL‐c in diabetic bitches (Group 2) was significantly (p < 0.01) lower than that of the control and treated groups. Administration of insulin, insulin with vitamin C and insulin with vitamin E to diabetic bitches increased the levels of HDL‐c concentrations significantly compared to the diabetic animals not getting either compound. Administration of insulin with vitamins (C or E) was found to be more effective in elevating HDL‐c level than insulin administered alone.
The data of Table 2 included the activities of SOD, CAT, Gpx and value of MDA in the erythrocyte hemolysate of control and experimental Bitches. The activities of SOD, CAT and Gpx in bitches treated with insulin, insulin with vitamin C and insulin with vitamin E (Groups 3, 4 and 5 respectively) were lower than the control bitches. The activities of SOD, CAT and Gpx in the hemolysate were lowered significantly (p < 0.01) in diabetic bitches (Group 2) compared to the control (Group 1). Administration of insulin, insulin with vitamin C and insulin‐vitamin E simultaneously elevated the activities of these enzymes in the erythrocyte hemolysate of the diabetic bitches. However, insulin administered either with vitamin C or vitamin E was found to be more effective in elevating the values of examined enzymes than that of insulin administered alone.
The value of MDA in insulin treated bitches (Groups 3) was significantly increased than the normal value noted in the control bitches whereas its concentration in insulin‐vitamin C and insulin‐vitamin E treated bitches (Groups 4 and 5 respectively) were comparable to the control group. However, MDA value in diabetic bitches (Group 2) was significantly (p < 0.01) higher than control and treated groups. Administration of insulin, insulin with vitamin C and insulin with vitamin E to diabetic bitches decreased MDA value significantly compared to the diabetic animals not getting either compound. Administration of insulin with vitamins (C or E) was found to be more effective in lowering MDA value than insulin administered alone.
4. DISCUSSION AND CONCLUSION
Several features appear in DM including an increase in lipid peroxidation (Naziroglu
and Sqimsek 2004; Gumieniczek, 2005), alteration of the glutathione redox state, a decrease in the content of individual natural antioxidants, and finally a reduction in the antioxidant enzyme activities. These changes suggest an oxidative stress caused by hyperglycemia (Chaudhry et al., 2007). Many defense mechanisms are involved in against oxidative stress. Among these mechanisms, antioxidants such as ascorbic acid (vitamin C) and a‐tocopherol (vitamin E) play the role of a free‐radical scavenger (Karaoz et al., 2002; Naziroglu and Sqimsek 2004; Tucker and Townsen 2005).
The present results showed that, administration of insulin, insulin with vitamin C and insulin with vitamin E resulted in significant changes in the concentration of blood glucose,
162
Lucrări Științifice – vol 53 seria Medicină Veterinară
total cholesterol, LDL‐c, HDL‐c, SOD, CAT, Gpx and MDA. Literature information indicates that natural diabetic dogs are hyperglycemic and have increased oxidative stress (Comazzi et al., 2002). Observations in this study also correlate well with the previous research findings, in that the blood glucose levels were elevated significantly in diabetic bitches (Comazzi et al., 2002). There were marked fall in the blood glucose concentration of diabetic bitches administered insulin alone or in combination with either vitamin C or E. The better hypoglycaemic effect of insulin administered with vitamins than that of insulin alone perhaps attributed to one of two possibilities. The first possibility is that, supplementation of vitamins increased the antioxidant enzymes expressions and/or activities. Although pancreatic beta cell loss in diabetes is probably due to an autoimmune response, ROS produced during inflammation are considered as a predisposing factor, and increased mitochondrial ROS production during hyperglycemia may be central to much of the pathology of diabetes (Kowluru Renu et al., 2006; Nobuyo et al., 2006; Wagner et al., 2007). The second possibility is that, supplementation of vitamins inactivates the circulating free radicals that quench nitrous oxide before it reaches pancreatic beta cells, where induced their damage and/or death (Vina et al., 2006).
The reported increased level of total cholesterol and HDL‐c in diabetic bitches comes in agreement with previous studies (Betteridge, 1994; Naziroglu, et al., 2004). Studies have shown that increased plasma triglyceride and cholesterol levels may be a risk factor for vascular disease (Kamata and Yamashita 1999; Kamata et al 2001; Shahar et al., 2003). Also oxidative modification of LDL is an important step in the development of atherosclerosis (Felmeden et al., 2003). This oxidation is initiated and propagated by free radicals where antioxidants become depleted (Young and Woodside, 2001; Kaviarasan et al., 2005).
In this study, vitamin C or E when supplemented with insulin significantly reduced lipid profile in diabetic bitches compared to insulin treated diabetic bitches. This improvement in lipid profile in the present study is supported by previous studies that vitamin C (Anderson et al., 1999; Kurowska et al., 2000) prevents oxidation of LDL‐cholesterol; decreases total and LDL‐cholesterol and triglyceride; and also raises HDL‐cholesterol level. The superiority of administration of insulin with vitamins than insulin alone reflected the protective effect of vitamins against atherogenic properties of insulin. This was underlined by the reported increment of HDL‐c in the respective groups.
The possible explanation for the hypocholesterolaemic effect of vitamin C and vitamin E is that they prevents LDL‐cholesterol from oxidative damage and aids in degradation of cholesterol. Secondly, it has been suggested that these vitamins are needed by the enzyme in the first step of bile acid synthesis (cholesterol 7α‐hydroxylase) by directing cholesterol towards bile acid synthesis and reduces its level in serum (White et al., 1994). Kaviarasan et al. (2005) reported that level of total cholesterol, triglyceride, lipid peroxidation and glucose increased in hyperlipidemic patients with DM whereas there was decreased plasma concentration of vitamin C, E and other antioxidants. Taking the above evidence together suggest that vitamin C and E supplementation improves the lipid profile of diabetic bitches by acting through cholesterol 7α‐hydroxylase to direct cholesterol into bile synthesis. Furthermore, by scavenging free radicals it decreases oxidative damage to oxidized LDL‐cholesterol.
The significant (p < 0.01 %) decrease in the activity of antioxidant enzymes, SOD, CAT and Gpx in diabetic bitches (Table 2) are agree with the previous results in rats (Kedziora, et al., 2000; Vessby, et al., 2002). The authors reported that, antioxidant capacity in plasma of type –1 diabetic rats was shown to be lower than that of the normal animals, and they returned this reduction to decreased activity of antioxidant enzymes.
163
Universitatea de Științe Agricole și Medicină Veterinară Iași
The present work demonstrated a potential and beneficial effect of combined
administration of insulin either with vitamin C or E in attenuating oxidative stress and enhancing the body’s own antioxidant defenses in diabetic bitches with established oxidative stress. As tabulated in the result section, most of the evaluated parameters exhibited a significant restoration which was comparable to that of normal control. In the contrary, the enzymatic antioxidants and cell damages as reflected on MDA value in erythrocyte hemolysate remained significantly altered in the diabetic control bitches.
The antioxidant enzymes Gpx, CAT and SOD are known to be inhibited in diabetes mellitus as a result of non‐enzymatic glycosylation and oxidation. The positive impact of treatment of DM using vitamins (C and E) on these enzymes observed in the present study could be explained by two possible mechanisms. First, the antioxidative effect of vitamins C or E perhaps prevent further glycosylation and peroxidation of proteins by interacting with free radicals minimizing their serious effects. Second, vitamin C or E may induce the protein synthesis of these enzymes, which explains the observed elevated activity after treatment. The present results come in accordance with the previous researches (Vina et al., 2006; Borras et al., 2005; Pawlowska‐Goral et al., 2002; Vimal and Devaki 2004). The authors found that polyphenolic substances such as estrogens, flavonoids and vitamins increased the expression of SOD and GPX enzymes at the transcriptional level. In conclusion of this section, treatment of diabetic bitches in this study with vitamins C or E with the main drug (insulin) showed a significant restoration in the levels of SOD, CAT, and GPX activity.
Although several criteria are without doubt required to adequately describe a biomarker, the entire basis of the biomarker is the measurement of compound that directly reflects certain biological events related to pathogenesis of a disease or condition (Lykkesfeldt, 2007). Thus the rational of MDA as a biomarker relies both that it is derived from lipid peroxide, that changes in lipid oxidation levels reflects the changes in MDA concentration.
The significant (p < 0.01 %) increased level of MDA in diabetic bitches (Table 2) in this study reflected the increased lipid peroxidation due to diabetes. This principle was previously observed by Rahimi et al. (2005) who approved the increases in lipid peroxidation were usually accompanied diabetic patient. Numerous studies have demonstrated that antioxidant vitamins and supplements can help in lowering the markers indicative of oxidant stress and lipid peroxidation in diabetic subjects and animals (Naziroglu et al., 2005 and Penckofer, et al., 2002).
In the present study, we observed that vitamin C or vitamin E supplementation to diabetic bitches improved the lipid peroxidation process as compared with diabetic condition as appeared in the significant (p < 0.01 %) reduction in the levels of MDA as oxidative damage biomarker (Table 2). Also we observed the more obvious reduction of MDA levels in insulin vitamins treated group than insulin group. These results could be explained by the previous observation of Naziroglu et al., (2005) who found that, vitamin C is shown to be an important antioxidant, to regenerate vitamin E through redox cycling, and to raise intracellular glutathione levels. Thus vitamin C plays an important role in protein thiol group protection against oxidation. It has been proposed that, Vitamin C recycles Vitamin E by a non‐enzymatic reaction. Additional interactions have been also reported between vitamin C and vitamin E. Vitamin C is associated with the recycling of an important cellular antioxidant, the glutathione and functions with it as a redox couple (Winkler et al., 1994). Glutathione is also involved in the recycling of Vitamin E by an enzymatic mechanism (McCay, 1985; Chan, 1993). Another possibility is that, supplementation of vitamin (C and E) inactivates the circulating free radicals
164
Lucrări Științifice – vol 53 seria Medicină Veterinară
that quench NO before it reaches pancreatic beta cells, where induced their damage and/or death (Vina et al., 2006).
The current study indicated that, administration of the examined dose of either vitamin C or vitamin E with insulin were effective in inhibiting hyperglycaemia, hypercholesterolemia, oxidative stress and lipid peroxidation than insulin alone. These effects were almost the same whatever the vitamin used.
5. REFERENCES 5. Adams, B., Chan, A., Callahan, H., Siwak, C., Tapp, D., Ikeda‐Douglas, C., Atkinson, P., Head, E.,
Cotman, C.W., Milgram, N.W., 2000. Use of a delayed non‐matching to position task to model age‐dependent cognitive decline in the dog. Behav. Brain. Res. 108, 47– 56.
6. Aebi, H., 1984. Methods Enzymol 105, 121‐126. 7. Anderson J W, Gowri M S and Turner J. 1999. Antioxidant supplementation effects on low‐
density lipoprotein oxidation for individuals with type 2 diabetes mellitus; J. Am. Coll. Nutr. 18, 451–461
8. Annunziata L, Domenico F, Pietro T. 2005. Glyco‐oxidation in diabetes and related diseases. Clin Chim Acta; 2:236–50.
9. Bauer, J.D., 1982, Clinical laboratory methods 9th ed, The C.V. Company II 1830, Westline industrial, Missouri, Chap. 33.
10. Betteridge D. J. 1994. Diabetic dyslipidemia; Am. J. Med. (Suppl. 6A) 96, 255–315. 11. Borras C., Gambini J., Gomez‐Cabrera M. C., Sastre J., Pallardo F. V., Mann G. E., et al. 2005.
17ßoestradiol up‐regulates longevity‐related, antioxidant enzyme expression via the ERK1 and ERK2 [MAPK]/NFkB cascade. Aging Cell; 4:113‐8.
12. Chan A. C. 1993. Partners in defense, vitmian E and vitamin C. Can. J. Physiol. Pharmacol. 71:725‐731
13. Chaudhry J, Ghosh NN, Roy K, Chandra R. 2007. Antihyperglycemic effect of a thiazolidinedione analogue and its role in ameliorating oxidative stress in alloxan‐induced diabetic rats. Life Sci.; 80:1135‐42.
14. Comazzi, S., Paltrinieri, S., Spagnolo, V., Sartorelli, P. 2002. Some aspect of erythrocyte metabolism in insulin‐ treated diabetic dogs. Research in veterinary Science, 72. 23‐27
15. Davison, L. J., Herrtage, M. E., Steiner, J. M., Williams, D. A. & Catchpole, B., 2003. Evidence of anti‐insulin autoreactivity and pancreatic inflammation in newly diagnosed diabetic dogs. J. Vet. Intern. Med. 17: 395 (abs.).
16. Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. 1997. Report of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes Care 20: 1183–1197.
17. Felmeden D C, Spencer C G, Blann A D, Beevers D G and Lip G Y 2003 Low‐density lipoprotein subfraction and cardiovascular risk in hypertension: Relationship to endothelial dysfunction and effects of treatment; Hypertension 41, 528–533.
18. Felsburg, P., 2002. Overview of immune system development in the dog: comparison with humans. Human Exp. Toxicol. 21, 487–492.
19. Gumieniczek A. 2005. Effects of pioglitazone on hyperglycemia‐induced alterations in antioxidative system in tissues of alloxan‐treated diabetic animals. Exp Toxicol Pathol; 56:321‐6.
20. Hoenig, M. & Dawe, D., 1992. A qualitative assay for beta cell antibodies. Preliminary results in dogs with diabetes mellitus. Vet. Immunol. Immunopathol. 32: 195–203.
21. Kamata K. and Yamashita K. 1999. Insulin resistance and impaired endotheliium‐dependent renal vasodilation in fructose‐fed hypertensive rats; Res. Commun. Mol. Pathol. Pharmacol. 103,195–200
165
Universitatea de Științe Agricole și Medicină Veterinară Iași
22. Kamata K., Kanie N, and Inose A. 2001. Mechanisms underlying attenuated conntractile
respoonse of aortic rings to noradrenaline in fructose‐fed mice; Eur. J. Pharmacol. 428, 241–249
23. Karaoz E, Gultekin F, Akdogan M, Oncu M, Gokcimen A. 2002. Protective role of melatonin and a combination of vitamin C and vitamin E on lung toxicity induced by chlorpyrifos‐ethyl in rats. Exp Toxicol Pathol.; 54:97‐108.
24. Kararli, T., 1995. Comparison of the gastrointestinal anatomy, physiology, and biochemistry of humans and commonly used laboratory animals. Biopharm. Drug Dispos. 16, 351–380.
25. Kaviarasan K., Arjunan M. M., and Pugalendi K. V. 2005. Lipid profile, oxidant‐antioxidant status and glycoprotein components in hyperlipidemic patients with/without diabetes; Clin. Chim. Acta 362, 49–56.
26. Kearns, R., Hayek, M., Turek, J., Meydani, M., Burr, J., Greene, R., Marshall, C., Adams, S., Borgert, R., Reinhart, G., 1999. Effect of age, breed and dietary omega‐6 (n‐6) :omega‐3 (n‐3) fatty acid ratio on immune function, eicosanoid production, and lipid peroxidation in young and aged dogs. Vet. Immunol. Immunopathol. 69, 165–183.
27. Kedziora‐Kornatowska KZ, Luciak M, Paszkowski J. Lipid peroxidation and activities of antioxidant enzymes in the diabetic kidney: Effect of treatment with angiotensin convertase inhibitors. IUBMB Life 2000;49:303–30.
28. Kowluru Renu A, Kowluru Vibhuti, Xiong Ye, Ho Ye‐Shih. 2006. Overexpression of mitochondrial superoxide dismutase in mice protects the retina from diabetes‐induced oxidative stress. Free Radic Biol Med.; 41:1191‐6.
29. Kurowska E. M., Spence J. D., Jordan J., Wetmore S., Freeman D. J, Piche L A and Serratore P. 2000. HDL‐cholesterol‐raising effect of orange juice in subjects with hypercholesterolemia; Am. J. Clin. Nutr. 72, 1095–1100
30. Lopes‐Virella, M.F., Stone, P., Ellis, S., and Colwell, J.A., 1977. "Cholesterol determination in high density lipoproteins separated by the three different methods, " Clin. Chem., 23(5), pp. 882‐884.
31. Lykkesfeldt, J., 2007. Malondialdehyde as biomarker of oxidative damage to lipids caused by smoking. Clinica Chimica Acta 380, 50–58.
32. McCay P. B. 1985. Vitamin E: interactions with free radicals and ascorbate. Annu. Rev. Nutr. 5:323‐340, 27.
33. Morgan V. 2008. Handbook of Small Animal Practice. The 5th edition. SAUNDERS, Printed in the United States of America.
34. Naziroglu M, Sqimsek M. 2004. Effects of hormone replacement therapy with oral vitamin C and E on plasma thyroid hormone levels in postmenopausal women with type 2 diabetes. Biomed Pharmacother.
35. Naziroglu M, Butterworth P., 2005. Protective effects of moderate exercise with dietary vitamin C and E on blood antioxidative defense mechanism in rats with streptozotocin‐induced diabetes. Can J Appl Physiol.30 (2):172–85.
36. Nishikimi, M., Appaji N., and Yogi. K. 1972. The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen. Biochem. Bioph. Res. Commn. 46(2), 849‐854 .
37. Nobuyo, M., Frei Balz, Heinecke Jay W. Vitamin C fails to protect amino acids and lipids from oxidation during acute inflammation. Free Radic Biol Med 2006;40:1494‐501.
38. Ohkawa,H. ;Ohishi,w. and Yagik, 1979. Annal;.Biochem. ;95,351 39. Pawlowska‐Goral K., Kusz E., Wardas M., Damek E. and Wardas P. 2002. The results of the
interference of nitrates and vitamin E in the metabolism in the connective tissue of rat’s liver. Exp Toxicol Pathol.; 54:147‐50.
40. Penckofer, S., Schwertz, D., Florczak, K., 2002. Oxidative stress and cardiovascular disease in type 2 diabetes: the role of antioxidants and prooxidants. J Cardiovasc Nurs .16(2):68–85.
41. Rahimi R., Nikfar S., Larijani B. and Abdollahi M. 2005. Dossier: Antioxidants in the prevention of human diseases. A review on the role of antioxidants in the management of diabetes and its complications. Biomedicine & Pharmacotherapy, 59, 365–373.
166
Lucrări Științifice – vol 53 seria Medicină Veterinară
42. Rotruck J. T., Pope A. L. and Ganther H. E. 1973. Selenium: Biochemical role as a component
of glutathione peroxidase. Science 179: 588‐590. 43. SAS, 1987. Statistical Analysis System, Users Guide: Statistics, SAS Institute Cary , North
Carolina. 44. Sasaki T,
Matsy S, Sonae A (1972) Effect of acetic acid concentration on the colour reaction in the o‐toluidine boric acid method for blood glucose estimation. Rinshokagaku 1: 346‐353.
45. Schwedhelm E., Maas R., Troost R. and Boger R. H. 2003. Clinical pharmacokinetics of antioxidants and their impact on systemic oxidative stress. Clin Pharmacokinet; 42:437–59.
46. Shahar E, Chambless L. E, Rosamond W. D., Boland L. L., Ballantyne C. M., McGovern P. G. and Sharnett A. R. 2003. Atherosclerosis risk in community study, plasma lipid profi le and incident ischaemic stroke: the atherosclerosis risk in communities (ARIC) study; Stroke 34, 623–631
47. So¨zmen EY, So¨zmen B, Delen Y. and Onat T. 2001. Catalase/superoxide dismutase (SOD) and catalase/paraoxonase (PON) ratios may implicate poor glycemic control. Arch Med Res;4:283–7.
48. Tavridou A, Unwin NC, Laker MF, White M, Alberti GK. 1997. Serum concentrations of vitamin A and E in impaired glucose tolerance. Clin Chim Acta; 266:129–40.
49. Tucker J. M and Townsen D.M. 2005. Alpha‐tocopherol: roles in prevention and therapy of human disease. Biomed Pharmacother; 59:380‐7.
50. Vessby, J., Basu, S., Mohsen, R., Berne, C. and Vessby B. (2002). Oxidative stress and antioxidant status in type 1 diabetes mellitus. J. Internal Med. 251:69‐76.
51. Vimal V and Devaki T. 2004. Linear furanocoumarin protects rat myocardium against lipidperoxidation and membrane damage during experimental myocardial injury. Biomed Pharmacother; 58:393‐400.
52. Vina J, Borras C., Gomez‐Cabrera M. C. and Orr W. C. 2006. Role of reactive oxygenspecies and (phyto)oestrogens in the modulation of adaptive response to stress. Free Radic Res; 40:111‐9.
53. Wagner James G, Jiang Qing, Harkema Jack R, Illek Beate, Patel Dhavalkumar D, Ames Bruce N, et al. 2007. Ozone enhancement of lower airway allergic inflammation is prevented by g‐tocopherol. Free Radic Biol Med.; 43:1176‐88.
54. Winkler, B. Stephen M., and Tonia S. 1994. The redox couple between glutathione and ascorbic acid: A chemical and physiological perspective. Free Radical Biology and Medicine, 17, 333‐349.
55. White, A., Handler P., Smith E. L., Hill R L and Lehman I. R. 1994. Principles of biochemistry 7th edition (Tokyo: McGrawHill Kogakusha Ltd) pp 619–630
56. Young, I.S. and Woodside J.V. 2001. Antioxidants in health and disease; J. Clin. Pathol. 54, 176–186
57. Zak, B., Dickenman, R., Whitsee, E., Burnett, H., and Cherney, P., 1954. "Rapid estimation of free and total cholesterol, " Am. J. Clin. Path., 24(1), pp. 1307‐1315.
167
Universitatea de Științe Agricole și Medicină Veterinară Iași
Figure 1: Diagrammatic representation of experimental protocol
A total of 40 bitches were used in the experiment
Group 1 contained 10 non diabetic bitches served as non diabetic control
Group 2 contained 30 diabetic bitches
Samples of 10 of each served as diabetic control before treated with
Group 3 (10 animal) Treated with insulin
Group 4(10 animal) Treated with insulin and ascorbic acid
Group 5 (10 animal) Treated with
168
Lucrări Științifice – vol 53 seria Medicină Veterinară
Table 1: lipid profile and blood glucose level in control, diabetic, diabetic treated bitches Significant Difference at P<0.01 Means within the same column with different letters are significantly differed. Note: a, is the highest value, decreased via b, c, d to e.
Group 1: Control non diabetic bitches Group 2: Diabetic untreated bitches Group 3: Insulin treated bitches Group 4: Insulin‐vitamin C treated bitches Group 5: Insulin‐vitamin E treated bitches Table 2: Levels of SOD, CAT, GPx and MDA in erythrocyte hemolyste of control,
diabetic, diabetic‐ treated bitches
MDA(µmol/l)
GPx (mg/dl)
CAT (units/mg Hb)
SOD (units/mg Hb)
Parameters
16.9 ± 0.3b 22.0 ± 0.5a 0.08 ± 0.002a 0.07 ± 0.005a Group 1 28.4 ± 0.5a 14.0 ± 0.5d 0.05 ± 0.002d 0.02 ± 0.002d Group 2 24.5 ± 0.5a 16.2 ± 0.4c 0.06 ± 0.003c 0.03 ± 0.002c Group 3 17.3 ± 0.3b 19.2 ± 0.3b 0.07 ± 0.003b 0.05 ± 0.002b Group 4 18.4 ± 0.4b 19.6 ± 0.4b 0.07 ± 0.002b 0.05 ± 0.002b Group 5
Significant Difference at P<0.01 Means within the same column with different letters are significantly differed. Note: a, is the highest value, decreased via b, c, d to e. Group 1: Control non diabetic bitches Group 2: Diabetic untreated bitches Group 3: Insulin treated bitches Group 4: Insulin‐vitamin C treated bitches Group 5: Insulin‐vitamin E treated bitches
Parameters Glucose (mg/dl )
Cholesterol (mg/dl)
LDL (µmol/dl)
HDL (µmol/dl)
Group 1 86.6 ± 2.63c 126.3 ± 8.9e 25.3 ± 0.59c 264.7 ± 1.8a
Group 2 286.9 ± 5.20a 277.3 ± 2.9a 35.0 ± 0.47a 222.9 ± 7.3c
Group 3 99.8 ± 2.35b 192.0 ± 2.3b 32.2 ± 0.33 b 240.0 ± 4.4b
Group 4 88.8 ± 2.33c 170.0 ± 2.5d 26.6 ± 0.37c 263.8 ± 2.3a
Group 5 87.5 ± 2.21c 184.0 ± 4.0c 27.6 ± 0.37c 262.4 ± 4.4a
169
INVESTIGATION OF SELECTED BIOCHEMICAL INDICATORS OF EXERTIONAL RHABDOMYOLYSIS IN ARABIAN HORSES: PRO‐
INFLAMMATORY CYTOKINES AND OXIDATIVE STRESS MARKERS
Wael M. EL‐Deeba, Abd EL‐Aziz Almujallib , S. M. El‐Bahrc
a (Corresponding author)
Department of clinical studies, College of Veterinary Medicine and animal Resources, King Faisal University.
Saudi Arabia, AL‐Ahsa, 31982. e‐mail: drwaeleldeeb@yahoo.com
b Department of clinical studies, College of Veterinary Medicine and animal Resources, King
Faisal University. Saudi Arabia, AL‐Ahsa, 31982.
c Department of Physiology, Biochemistry and Pharmacology, College of Veterinary Medicine and animal Resources, King Faisal University, Saudi Arabia, AL‐Ahsa, 31982.
Abstract A total of 30 horses were divided into two groups, one served as a control whereas other was exertional rhabdomyolysis (ER)‐diseased horses. After blood collection, the resulted sera were used for estimation of the activities of creatin kinase (CK), aspartate transaminase (AST), lactate dehydrogenase (LDH), lactic acid, total triacylglycerol, glucose, total protein, albumin, globulin, urea, creatinine, Triiodothyronine (T3), calcium, sodium, potassium, phosphorus, chloride, vitamin E, interleukin‐6 (IL‐6) and tumor necrosis‐α (TNF‐α). In addition, whole blood was used for determination of selenium, reduced glutathione (G‐SH) and prostaglandin F2‐α (PGF2α). The erythrocyte hemolysates were used for the determination of the activities of super oxide dismutase (SOD), catalase (CAT), total antioxidant capacity (TAC), nitric oxide (NO) and malondialdehyde (MDA). The present findings revealed a significant (p≤ 0.05) increase in the values of CK, AST, LDH, glucose, lactate, TAG, urea, creatinine, phosphorus, MDA, TNF‐ α, IL6 and PGF2‐ α in diseased horses when compared with the control. In addition, the values of calcium, SOD, CAT, TAC, NO and GSH in diseased horses were significantly (p≤ 0.05) lower than the control. The other examined parameters remained unchanged. In conclusion, the examined pro‐inflammatory cytokines could be added to old biomarkers for the diagnosis of ER in Arabian horses. In the future, efforts should be made to confirm this in other breed. If this could be achieved, it would open up new perspectives in research fields dealing with ER not only in animals, but also in humans.
Key words: Rhabdomylosis, horse, IL6, oxidative stress, TNF‐α, PGF2‐ α. 1. INTRODUCTION Muscle disorders are a common cause of suboptimal performance or even disability to perform. In comparison to human medicine, the etiology of muscle disorders in equine medicine is less explored. Tying‐up or ER was previously known as Monday‐morning disease (Zentek, 1991). Monday morning disease was associated with work horses that was given a
170
Lucrări Științifice – vol 53 seria Medicină Veterinară
day of rest after a week of hard work. When the horses were supposed to return to work on the following Monday, they developed stiffness and pain in the hindquarter musculature, and reluctance to move (Jones, 2003). Arabians horses are one of the affected breed (Valentine et al., 2000; McKenzie et al., 2003).
The underlying cause of this metabolic disorder is not yet known but is thought to involve carbohydrate metabolism (Valberg et al., 1997). Clinical signs of ER, including muscle pain, cramping, stiffness, sweating, exercise intolerance, weakness, and reluctance to move may be observed, with the hindquarters most frequently affected (Firshman et al., 2003). In order to confirm a diagnosis of ER blood samples should be obtained to determine serum CK and AST. Their elevation indicates muscle damage and confirms the diagnosis of the disease. In addition, AST activity may be heightened in asymptomatic horses with chronic ER.
Exercise has been shown to induce tissue damage by oxidation of cellular components, such as membrane lipids, proteins, carbohydrates and DNA (Clarkson and Thompson, 2000). The main sources of reactive oxygen species (ROS) that are generated during exercise are the mitochondria (respiratory chain), although activated phagocytes (respiratory burst) and several enzymes such as oxidases perhaps contribute to an increased ROS release (Leeuwenburgh and Heinecke, 2001). Living organisms possess antioxidant defense systems against ROS. These defense systems include endogen antioxidants, which can be classified as non enzymatic (vitamin E, vitamin C, uric acid) and enzymatic defense system. The most important antioxidant enzymes are SOD and CAT (Fridovich, 1995). If the pro‐oxidant burden overwhelms the endogenous antioxidant defenses of the organism, the arising imbalance between pro‐ and antioxidants is resulted which defined as oxidative stress (Sies, 1991). Exercise‐induced oxidative stress is believed to contribute to accelerated muscle fatigue and muscle fiber damage, leading to exercise intolerance and poor performance in different animal species (Sen and Packer, 2000), as well as to a decreased immune defense of the organism (Nieman, 1997). If the importance of antioxidant deficiencies for exercise‐induced oxidative stress and exercise intolerance has been clearly established, thereby that supplementation of antioxidants might improve performance, remains to be proven (Clarkson and Thompson, 2000; Jenkins, 2000).
Electrolyte imbalances were believed to have an important role in causing ER in some pleasure and racehorses. Studies by Harris and Snow (1991) in the United Kingdom have focused on determining electrolyte balance in horses with tying‐up. Commercial diets were found to be too low in salt (sodium chloride) and most horses needed an additional 1‐2 ounces of salt to maintain proper balance. While some horses improved dramatically by adding electrolytes in the form of table salt (sodium chloride), lite salt (potassium chloride), or Epsom salt (magnesium chloride), other horses showed no improvement. Trace‐elements, such as selenium (Se), zinc (Zn), copper (Cu) and manganese (Mn) play an important catalytic role for the enzymatic activity of SOD (Maughan, 1999; Mates, 2000). Strenuous exercise induced a transient endotoxemia and a pro‐inflammatory condition in the horse that persists for approximately 2 h after exercise (Douglas et al., 2007). IL‐6 is an important mediator of inflammation. The pleiotrophic cytokine IL‐6 is involved in directing the innate immune response to acquired immunity (reviewed by Jones (2005), and has been described as a regulatory cytokine in osteoarthritis (Goldring, 2000). It stimulates production of metalloproteinase inhibitors (Shingu et al., 1993, 1995), but also potentiates the catabolic effects of IL‐1 and TNF‐α on proteoglycan metabolism (Jikko et al., 1998; Flannery et al., 2000). According to authors knowledge there is no data concerning the oxidant‐antioxidant balance or pro‐inflammatory response in cases of ER in Arabian horses. Therefore,
171
Universitatea de Științe Agricole și Medicină Veterinară Iași
the present study aimed to investigate new biomarkers, oxidative stress markers and pro‐inflammatory cytokines for diagnosis of ER in Arabian horses. 2. MATERIAL AND METHODS 2.1. Animals
A total of 30 horses (4‐6 years old) were used in the present study. They were divided into two groups. Horses of the first group (10 horses) were clinically healthy and served as a control group. Horses of the second group (20 horses) were ER‐ diseased horses. They were selected on the basis of clinical examination and laboratory findings and they had a history of over exercise after a period of rest and overfeeding of non‐structural carbohydrates (grains). 2.2. Sampling protocol
Blood samples were collected from the ear vein from all groups in fresh plain vial for serum collection and heparinized vials for whole blood, serum and erythrocyte hemolysate preparations. Sera were used for estimation of the activities CK, AST, LDH. In addition, lactic acid, total triglycerides, glucose, total protein, albumin, globulin, urea and creatinine were also determined. Sera samples were also used for the determination of T3, calcium, sodium, potassium, phosphorus, chloride, vitamin E, IL‐6 and TNF‐α. However, whole blood was used for the determination of selenium, G‐SH and PGF2‐α. The erythrocyte hemolysates were used for the determination of the activities of SOD, CAT, TAC, NO and MDA. 2.3. Preparation of hemolysate
After collecting blood samples in heparinized tubes, centrifugation was performed at 1000g for 15 min to remove the buffy coat. The packed cells obtained at the bottom were washed thrice with phosphate buffer saline (0.9% NaCl in 0.01 M phosphate buffer, pH 7.4). Erythrocytes were lysed with hypotonic phosphate buffer. The hemolysate was obtained after removing the cell debris by centrifugation at 3000g for 15 min. 2.4. Determination of selected biochemical parameters
Enzymatic methods of Bio‐diagnostic kits were used for colorimetric determination of serum glucose concentration (Trinder, 1969), TAG (Young et al., 1972), total protein (Henry, 1984), albumin (Doumas et al., 1981), globulin (Coles, 1974), AST (EC 2.6.1.1; Reitman and Frankel, 1957), urea (Tabacco et al., 1979) and creatinine (Henry, 1984) according to manufacturing instructions. In addition, the activities of CK (Faulker and Meites 1982), LDH (EC 1.1.1.27; Wroblewski and Duean 1955), and value of Lactate (Donawick et al., 1975) were also determined in the serum by using commercial available kits (Bio‐diagnostic kits).
Serum concentration of T3 hormone was determined using a solid phase competitive chemiluminescence immuno‐assay system (Elecsys 2010, Roche, Diagnostic, Mannheim). Concentrations were determined using kits, controls, mono‐clonal mouse antibodies and reagent supplied by Roche, Diagnostic, 2005 .The intra – and inter assay coefficients of variation (C.V. %) were 3.6 and 5.4%.`The minimum detectable levels of the assay were 0.195ng /ml. 2.5. Determination of electrolytes and vitamin E
Serum calcium was determined colorimetrically by using commercial the kit of Invitro Scientific according to the method described by Moorehead and Briggs, (1974). Calcium reacts with cresolphthalein complexone to form purple color complex in alkaline medium. The intensity of the color measured photometrically between wavelength 540 and 600nm with the maximum absorbance at 575 nm is directly proportional to calcium concentration in the
172
Lucrări Științifice – vol 53 seria Medicină Veterinară
specimen. The serum inorganic phosphate was determined according to the method cited in Wootton, (1982). The substituted phenol was used as a reducing agent and pH was adjusted by an acetate buffer. The color development was hastened by copper present in the buffer. The blue color was stable at least for 30 minutes. Sodium, potassium, and chloride were analyzed using the same commercial available test kits according to the methods described by Friedman and Young (1997) and Tietz, (1995).
However, whole blood selenium was measured using the Unicam 939 AA spectrometer and AAS hydride technique. Serum vitamin E was measured by HPLC (Kontron Instruments, Rotkreuz, Switzerland) using acetate of alpha tocopherol as internal standard (Paolisso et al., 1993). Chromatographic separation was performed using a reversed phase silica gel column (Alltech, Templeuvre, France) and an isocratic elution with acetonitrile. Detection was performed photometrically at 292nm.
2.6. Determination of oxidative stress markers and pro‐inflammatory mediators
Activity of SOD (inhibition rate percent) was assayed in erythrocyte hemolysate as described by Nishikimi et al. (1972) using commercial available kits (Bio‐diagnostic, Kit number SD2520). The activity of CAT was assayed in the erythrocyte by the method of Aebi, (1984) using commercial available kits (Bio‐diagnostic, Kit number CA2516). The activity of the enzyme was expressed as units/mg of hemoglobin. Whole blood GSH was determined spectrophotometrically using the Bio‐diagnostic kit (GR2510). Intra‐ and inter‐assay CV were 1% and 3%, respectively. TAC was assayed in erythrocyte hemolysate as described by koracevic et al. (2001) using commercial available kits (Bio‐diagnostic, Kit number TA2512). NO was assayed in hemolysate as described by Montgomery and Dymock (1961) using commercial available kits (Bio‐diagnostic, Kit number NO2532). Lipid peroxidation was assayed by the measurement of MDA levels on the base of MDA reacted with thiobarbituric acid at 532 nm, according to Ohkawa et al. (1979) using commercially supplied kits (Bio‐diagnostic, Kit number MD2529).
Serum concentrations of TNF‐α were determined using an ELISA assay developed with commercially available reagents, and an equine recombinant TNF‐α standard. Standard ELISA plates (96 well, flat bottoms, Immulon 4HBX, Milford, MA) were coated with polyclonal antibody recognizing equine TNF‐α (PETFNAI, Endogen, Thermo‐Fisher Scientific, Pittsburg, PA). The antibody was diluted 1:333 in carbonate buffer at pH 9.6 and 100 μl of antibody was added to each well. The microtiter plates were incubated overnight at 4ºC, after which the antibody was removed and the wells were filled with 100 μl of blocking buffer (1% BSA in 1X PBS). The plates were incubated for 1h at room temperature. Then the plates were washed three times with PBS containing 0.05% Tween 20 (PBST). Afterwards, 100 μl of each sample or standard was added to triplicate wells, and the plates were incubated at 37 ºC for 2h. The plates were washed three times with PBST. Biotin labeled polyclonal antibody against TNF‐a (PETNFABI, Endogen) was diluted 1:277 in PBST, and 100 μl was added to each well. The plates were incubated at 37 ºC for 90 min, after which they were washed three times with PBST. Next, 100 μl of avidin‐horseradish peroxidase conjugate, (Pharmingen, BD, Franklin Lake, NJ) diluted 1:5000 in PBST containing 0.5% bovine serum albumin, (Sigma, St. Louis, MO) was added to each well and incubated for 1h at room temperature. The plates were then washed five times with PBST. Finally, 100 μl of substrate (2,20‐azino‐di‐(3‐ethylbenzthiazoline sulfonic acid), Sigma A1888, ABTS) was added to each well. The plates were incubated for 30 min at room temperature in the dark, and then read at 405 nm on an automated microplate reader (Dynex MRX II, Dynex Technology, Inc., Chantilly, VA).
173
Universitatea de Științe Agricole și Medicină Veterinară Iași
Serum IL‐6 values were determined by using ELISA kits supplied by Abazyme, LLC, USA
(Catalog Number EL10023). This IL‐6 enzyme linked immunosorbent assay (ELISA) applies a technique called a quantitative sandwich immunoassay. The microtiter plate provided in this kit has been pre‐coated with a monoclonal antibody specific to IL‐6. Standards or samples are then added to the appropriate microtiter plate wells with a biotin‐conjugated polyclonal antibody preparation specific for IL‐6 and incubated. IL‐6 if present, will bind and become immobilized by the antibody pre‐coated on the wells and then be “sandwiched” by biotin conjugate. The microtiter plate wells are thoroughly washed to remove unbound IL‐6 and other components of the sample. In order to quantitatively determine the amount of IL‐6 present in the sample, Avidin conjugated to Horseradish Peroxidase (HRP) is added to each microplate well and incubated. Avidin is a tetramer containing four identical subunits that each has a high affinity‐binding site for biotin. The wells are thoroughly washed to remove all unbound HRP‐conjugated Avidin and a TMB (3,3',5, 5' tetramethyl‐benzidine) substrate solution is added to each well. The enzyme (HRP) and substrate are allowed to react over a short incubation period. Only those wells that contain IL‐6, biotin‐conjugated antibody and enzyme‐conjugated Avidin will exhibit a change in colour. The enzyme‐substrate reaction is terminated by the addition of a sulphuric acid solution and the colour change is measured spectrophotometrically at a wavelength of 450nm ± 2 nm. The concentration of IL‐6 in the samples (pg/mL) is then determined by comparing the O.D. of the samples to the standard curve. The minimum detectable level was 2pg/ml. Inter and intra assay coefficients were 5.8 and 6%, respectively and the recovery was 95%.
Blood was collected into sterile microcentrifuge tubes containing a solution of EDTA and sodium meclofenamate (final concentration: 10 mM, Sigma, St. Louis, MO) for the determination of prostaglandin concentrations. The samples were placed on ice for 10 min, after which they were centrifuged at 1000g for 20 min at 4ºC. The plasma was then harvested and stored frozen at –80 ºC until analysis. On the day, the assay was performed, 100 μl of plasma was added to 900μl of methanol, vortexed for 30 seconds and then dried down by evaporation. Concentrations of prostaglandins (13, 14‐dihydro‐15‐keto prostaglandin F2α) were evaluated using the ACETM competitive enzyme immunoassay (Cayman Chemical, Ann Arbor, MI).
2.8. Statistical analysis
The obtained data of the examined acute phase proteins were compared between groups within different concentrations by using computer package of the statistical analysis system (SAS, 1997). All data are presented as means ± standard error (S.E.) of the means. 3. RESULTS 3.1. Clinical signs
The observed clinical signs were in the form of pronounced sudden muscular weakness and stiffness, depression, reluctant or unable to move, colic, anorexia, muscle tremors and myoglobinuria. All clinical signs were recorded shortly after exercise. In addition, rectal palpation of the diseased group revealed highly distended bladder in 14 horses.
3.2. Selected biochemical indicators in control and diseased horses
The data summarized in Table 1 included the activities of CK, AST and LDH. In addition the table also contains the values of glucose, lactate, TAG, urea and creatinine in control and diseased horses. The present findings (Table 1) revealed a significant (p≤ 0.05)
174
Lucrări Științifice – vol 53 seria Medicină Veterinară
decrease in the activities of CK, AST and LDH whereas the values of glucose, lactate, TAG, urea and creatinine were significantly (p≤ 0.05) increase when compared with the control group. Values of the other examined parameters (Table 1) remained unchanged significantly (p≤ 0.05) in disease horses when compared with control group. 3.3. Electrolytes and vitamin E levels in control and diseased horses
The data of Table 3 included the values of calcium, sodium, potassium, phosphorus, chloride, vitamin E and selenium in control and diseased horses. The value of calcium in diseased horses (Groups 2) were significantly (p≤ 0.05) lower than the control horses. In the contrary, the value of phosphorus in diseased horses (Groups 2) were significantly (p≤ 0.05) higher than the control horses. Values of the other examined parameters (Table 3) remained unchanged significantly (p≤ 0.05) in disease horses when compared with control group. 3.4. Oxidative stress markers and pro‐inflammatory mediators
The data of Table 2 included the activities of SOD and CAT in addition the table also contains the values of GSH, TAC, NO, TNF‐ α, IL6 and PGF2‐ α and MDA in control and diseased horses. The activities of SOD, CAT and TAC in diseased horses (Groups 2) were significantly (p≤ 0.05) lower than the control horses. The values of MDA, TNF‐ α, IL6 and PGF2‐ α in diseased horse were significantly (p≤ 0.05) higher than the control horses whereas the values of NO and GSH were significantly (p≤ 0.05) lower in diseased horses when compared with the control group. Table 1: Selected biochemical indicators in control and diseased horses Parameters Control Diseased
CK (IU L_1 ) 202.6 ± 9.9 ٭ 86.76 ± 25.450
AST (IU L_1) 275.34 ± 6.6 ٭69.6 ± 30.990.0
LDH (IU L_1) 501.45 ± 8.9 ٭58.6 ± 24.540.0
Glucose (mmol L_1) 5.6 ± 1.2 9.5 ٭1.4 ±
T3 (ng/dl) 0.26 ± 0.02 0.25 ± 0.03
Lactate (mmol L_1) 1.0 ± 0.12 8.8 ٭1.01 ±
Total Protein (g/L) 66.8 ± 1.45 65.9 ± 1.66
Albumin (g/L) 28.88 ± 1.21 29.78 ± 0.56
Globulin (g/L) 34.45 ± 1.87 35.32 ± 1.98
TAG (mmol L_1) 1.0 ± 0.04 ٭0.56 ± 15.2
Urea (mmol/l) 7.32 ± 0.52 ٭1.22 ± 11.54
Creatinine (µmol/l) 118.43 ± 2.67 ٭6.45 ± 203.34
*Means are significantly different at the level (p≤ 0.05).
175
Universitatea de Științe Agricole și Medicină Veterinară Iași
Table 2: Oxidative stress markers and pro‐inflammatory mediators in control and diseased horses Parameters Control Diseased MDA (μmol/L) 1.0 ± 0.12 ٭0.12 ± 8.2CAT (U/mL) 1480.66 ± 543 ٭348.76 ± 612.32GSH (mg/dL) 2.8 ± 1.94 ٭0.22 ± 1.56TAC (mmol/l) 0.53 ± 0.39 ٭0.12 ± 0.23SOD (U/ml) 110 ± 6.26 ٭3.56 ± 66.23NO (µmol/L1) 4.11 ± 0.66 ٭0.12 ± 3.12TNF‐α (pg/ml_1) 95.4 ± 15.22 ٭32.43 ± 310.6PGF2‐α (pg/ml_1) 22.54 ± 2.13 ٭9.59 ± 357.63IL6 (pg/ml_1) 1.4 ± 0.65 ٭ 2.32 ± 5.62*Means are significantly different at the level (p≤ 0.05). Table 3: Electrolytes and vitamin E levels in control and diseased horses Parameters Control
(n=10) diseased (n=20)
Calcium (mmol/L) 3.12 ± 0.23 ٭0.21 ± 2.13Sodium (mmol/L) 144.8 ± 7.23 143.8 ± 6.45 Phosphorus (mmol/L) 1.3 ± 0.11 ٭0.12 ± 1.9Potassium(mmol/l) 4.16 ± 0.12 4.2 ± 0.13 Chloride (mmol/L) 107.5 ± 8.21 106.68 ± 6.66Selenium (μg/l) 109.6 ± 5.42 107.87 ± 7.91Vitamin E (μmol/l) 6.77 ±1.32 6.67 ±1.52 *Means are significantly different at the level (p≤ 0.05).
4. DISCUSSION In the current study, ER represented as when a conditioned horse is not worked and
kept on full feed high insoluble carbohydrates (such as grain), the horse will accumulate carbohydrates in the muscles. If there is a sudden demand for work, the body cannot adequately remove the rapidly accumulating lactic acid in the muscles. This in turn causes vasospasms and ischemia which means essentially that the surrounding blood vessels "clamp down" so that the lactic acid waste product cannot be removed. As a result, intracellular pH drops; the disrupted, hard and crampy muscle was observed when a horse ties up. In addition, ER is often seen following strenuous muscular exercise and is a response to intensive and severe exercise. It is associated with damage to the muscle group predominantly involved in the activity. The clinical signs observed in the present study are agree with previous researches (Clarkson, 2002; Hamer, 1997; Knochel, 1990; 1993; Line and Rust, 1995; Walsworth and Kessler, 2001)
The significant increase in serum CK, AST and LDH values suspected ER with respective muscle damage (Valentine et al., 2001; Sjaastad et al., 2004). The present results come in accordance with previous studies (Hosie et al., 1986; Whitwell et al., 1988; Brandt et al., 1997; Palencia and Rivero, 2007; Votion et al., 2007). Phosphocreatine is relatively short‐lived power source that is effective at generating ATP rapidly. It has a high‐energy phosphate group that is donated to ADP to produce ATP. It is used at the beginning of exercise to maintain high ATP levels during muscle contraction. Creatine kinase is the enzyme that catalyzes the conversion of phosphocreatine and ADP to creatine and ATP. Phosphocreatine stores are depleted more quickly in fast twitch muscle fibers since they have a higher rate of ATP utilization (Ivy et al.,
176
Lucrări Științifice – vol 53 seria Medicină Veterinară
1981). In the horse Phosphocreatine levels are decreased about 50 to 70% during high intensity exercise (Valberg and Essen‐Gustavson, 1987).
Elevated AST levels are also an indicator of muscle damage associated with recumbence (Skenderi et al., 2006; Valentine & Löhr, 2007). Elevated levels of AST are also thought to be indicative of liver damage (Nyblom et al., 2004). In the cell, AST is involved in formation of adenosine triphosphate (ATP; Pesch et al., 2006). The reported significant increase in glucose, lactate and triglycerides levels in diseased horses than that of the control perhaps attributed to increase the rate of glycogenolysis, glycolysis and lipogenesis, respectively. Feeding high insoluble carbohydrates to horses during rest increased the rate of glycogen storage. After rest period and when the animal exercised the animal get the energy through mobilization of glucose from glycogen storage site (glycogenolysis) followed by oxidation of the obtained glucose (glycolysis). In addition, gluconeogenesis may be activated. These mechanisms were enough to supply energy. Moreover, the excess glucose perhaps was used in synthesis of triacylglycerol (lipogenesis). This interpretation underlined by the reported significant increase in triacylglycerol of diseased horse in the present study. The reported increase in glucose, lactate and triacylglycerol was reported previously in horse (Westermann et al., 2007). The significant increase in urea and creatinine level in diseased horses (Table‐1) indicated renal damage. These findings disagree with those obtained by Clarkson (2006) who reported that, the renal system may not be affected in diseased horse.
Electrolytes are body salts that maintain an electrical gradient across muscle cell membranes. During exercise, muscles contract when nerves stimulate a change in the electrical gradient and electrolytes move across the cell membrane. Muscle cells contain high concentrations of the electrolytes potassium and phosphate and low concentrations of sodium, chloride, and calcium (Radostits, et al., 2007). If the ion pumps (sodium/potassium, calcium/magnesium and calcium/ATPase) in the membrane surrounding the muscle cell which move substrates in and out of the cell are disrupted, the interior environment of the muscle cells either cannot get rid of waste products of metabolism or has too much of a metabolic substrate to be able to function or can't get enough of a metabolic substrate to be able to function. Therefore, the muscle cell simply shuts down. When muscle cells shut down, they don't do so in the relaxed position, they freeze up in the contracted position, which resulted in rock‐hard muscles. Biochemically, it's not all that different from rigor mortis.
The reported hypocalcemia in the present study perhaps shared in generation of ER. The hypocalcemia as a suggesting cause of ER was reported before (Assmann et al., 1933 and Jacobson et al., 1991).
It was suggested that, similar to other species, a dietary vitamin E and selenium deficiency might cause muscle damage in ER horses. Vitamin E and selenium act to protect muscles from oxygen free radicals that can be generated with exercise. However, the present study did not reported changes in vitamin E and selenium level between diseased and healthy control horses. Therefore, either vitamin E or selenium deficiencies were avoided as a cause of ER in the present work. Documented cases of a selenium‐responsive muscle disease were reported in foals from several countries with low selenium soil content in the 1970s. The association with muscle disease led to the recommendation that horses with ER should be given a selenium and vitamin E supplement. Although selenium deficiency may not be the primary cause for ER, many practitioners report a decrease in the severity of tying‐up when horses receive vitamin E and selenium supplementation. This may be due to the fact that horses generate more toxic free radicals with the ER syndrome and therefore have a greater need for supplementation. Another possibility is enzymatic antioxidant activity might be
177
Universitatea de Științe Agricole și Medicină Veterinară Iași
higher in horses and protect the non enzymatic system from depletion. This underlined by the reported decrease in SOD and CAT of diseased horses (Nathalie et al., 2008).
The significant decrease of SOD, CAT, TAC, GSH and NO in diseased horse attributed to the depletion of antioxidant system to counteract the oxidative stress and reactive oxygen species. In the equine species, an exercise‐induced imbalance in favor of oxidants has been described in several experimental studies (Mills et al., 1997; Art et al., 1999; Deaton et al., 2002; Kirschvink et al., 2002) as well as in field investigations (Balogh et al., 2001; White et al., 2001; Hargreaves et al., 2002; Marlin et al., 2002). The production of NO plays a vital role in the regulation of physiologic processes, and both proinflammatory and anti‐inflammatory effects have been described for this molecule. NO is a biologic gas produced by almost all tissues. Recently it has been demonstrated that NO has an important role in muscle physiology (Balon et al., 1994) and may influence both contractile function and muscle metabolism. A physiologic role as a vasodilatory regulator in skeletal muscle has been established for NO, and in that way it increases O2 and nutrient supply to the muscle.
The significant decrease in the above discussed antioxidant system was underlined by the significant increase of MDA, TNF‐ α, IL6 and PGF2‐α in diseased horse indicated lipid peroxidation resulted from ER. Pro‐inflammatory molecules (TNF‐ α, IL6) have been reported to increase with strenuous exercise (Lee and Clarkson 2003). Furthermore, tissue damage and repair processes may involve the expression of inflammatory cytokines (TNF‐ α, IL6). Cytokines can act directly on target cells or they may stimulate the creation of secondary mediators such as other cytokines, PGF2‐α or free oxygen radicals.
Since some exercise‐related pathologic conditions are considered inflammatory processes (Lee and Clarkson, 2003), the present work designed to examine some pro‐inflamatory cytokines and prostaglandin in ER cases. To the authors knowledge this is the first study to demonstrate the use of pro‐inflammatory cytokines (IL‐6 and TNF‐ α) and PGF2‐α concentrations as biomarkers of ER. Similar significant increases in TNF‐ α, IL6 and PGF2‐α in horse of ER were reported in case of equine osteoarthritis (Ley et al., 2009), equine laminitis (Stewart, 2009), strenuous exercise in equine (Donovan et al., 2007) and others (for details see Art and Lekeux, 2005). 5. CONCLUSION
Interestingly, the examined pro‐inflammatory cytokines (TNF‐ α, IL6) and PGF2‐α concentrations could be added to other traditional biomarkers (CK, AST and LDH) used for the diagnosis of ER in Arabian horses. In the future, efforts should be made to confirm this in other breed. If this could be achieved, it would yield a valuable tool to diagnose ER and would open up new perspectives in research fields dealing with ER not only in animals, but also in humans. 6. Bibliography
1. Aebi, H. 1984. Catalase in vitro. Methods Enzymol. 105, 121‐126. 2. Art, T., Kirschvink, N., Smith, N., Lekeux, P., 1999. Indices of oxidative stress in blood and
pulmonary epithelium lining fluid in horses suffering from recurrent airway obstruction. Equine Veterinary Journal 31, 397–401.
3. Assmann H, Bielenstein H, Hobs H. 1933. Beobachtungen und untersuchungen bei der haffkrankheit. Dtsch Med Wochenschr 59, 122–6.
4. Balogh, N., Gaal, T., Ribiczeyne, S., Petri, A., 2001. Biochemical and antioxidant changes in plasma and erythrocytes of pentathlon horses before and after exercise. Veterinary Clinical Pathology 30, 214–218.
178
Lucrări Științifice – vol 53 seria Medicină Veterinară
5. Balon, T., Nadler, L., 1994. Nitric oxide release is present from incubated skeletal muscle
preparations. Journal Applied Physiology 77, 2519–2521. 6. Brandt, K., Hinrichs, U., Glitz, F., Landes, E., Schulze, C., Deegen, E., Pohlenz, J., Coenen,
M., 1997. Atypische myoglobinurie der weidepferde. Pferdeheilkunde 13, 27–34. 7. Clarkson, M., 2002. Exertional rhabdomyolysis: myths and madness. The American Journal
of Sports Medicine 4, 155‐156. 8. Clarkson, M., Thompson, S., 2000. Antioxidants: what role do they play in physical activity
and health? American Journal of Clinical Nutrition 72, 637S–646. 9. Clarkson, P., 2006. Case report of exertional rhabdomyolysis in a 12 year old boy.
Medicine and Science in Sports Exercise 38, 197–200. 10. Coles, H., 1974. Veterinary Clinical Pathology. W.B. Saunders Co., Philadelphia, London,
Toronto. 11. Deaton, M., Marlin, J., Roberts, A., Smith, N., Harris, A., Kelly, J., Schroter, C., 2002.
Antioxidant supplementation and pulmonary function at rest and exercise. Equine Veterinary Journal 34, 58–65.
12. Donawick, J., Ramberg, F., Paul, R. Hiza, A., 1975. The diagnostic and prognostic value of lactate determinations in horses with acute abdominal crisis. Journal of the South African Veterinary Association 466, 127.
13. Donovan, D., Jackson, C., Colahan, P., Norton, N., and Hurley, D., 2007. Exercise‐induced alterations in pro‐inflammatory cytokines and prostaglandin F2α in horses. Veterinary Immunology and Immunopathology 118, 263‐269.
14. Douglas C. Christie A., Patrick T., Natalie N., and David J., 2007. Exercise‐induced alterations in pro‐inflammatory cytokines and prostaglandin F2a in horses. Veterinary Immunology and Immunopathology 118, 263–269.
15. Doumas, T., Bayson, D., Carter, J., Peters, T., Schaffer, R., 1981. Estimation of total serum protein. Clinical Chemistry, 27, 1642‐1643.
16. Faulker, R. and Meites, S., 1982. Selected Method of clinical chemistry 9, 185. 17. Firshman, M., Valberg, S., Bender, J., Finno, C., 2003. Epidemiologic characteristics and
management of polysaccharide myopathy in Quarter Horses. American Journal of Veterinary Research 64, 1319–1327.
18. Flannery, R., Little, C., Hughes, C., Curtis, C., Caterson, B., Jones, S., 2000. IL‐6 and its soluble receptor augment aggrecanase‐mediated proteoglycan catabolism in articular cartilage. Journal of Biology 19, 549‐553.
19. Fridovich, I., 1995. Superoxide radical and superoxide dismutase. Annual Review of Biochemistry 64, 97–112.
20. Friedman, B. et al., 1980. Clinical chemistry, 26:1D. 21. Friedman, B., Young, D., 1997. Effects of Disease on Clinical Laboratory Tests, 3rd Edition,
AACC Press, Washington, D.C. 22. Goldring, B., 2000. Osteoarthritis and cartilage: the role of cytokines. Current
Rheumatology Reports 2, 459‐465. 23. Hamer, R., 1997. When exercise goes awry: exertional rhabdomyolysis. Southern Medical
Journal 90, 548‐551. 24. Hargreaves, J., Kronfeld, S., Waldron, N., Lopes, A., Gay, S., Saker, E., Cooper, L., Sklan, J.,
Harris, A., 2002. Antioxidant status and muscle cell leakage during endurance exercise. Equine Veterinary Journal 34, 116–121.
179
Universitatea de Științe Agricole și Medicină Veterinară Iași
25. Harris, A., and Snow, H., 1991. Role of electrolyte imbalances in the pathophysiology of
the equine rhabdomyolysis syndrome. In: Equine Exercise Physiology 3 ed. SGB Persson, A Lindholm and LB Jeffcott. ICEEP Publications, Davis CA, pp 435‐442.
26. Henry, B., 1984. Clinical Diagnosis and management, 17th edition, Saunder Publisher. Elecsys triiodothyronine (11731360122) and thyroxine (12017709122), Cobas, 2005, Roche, Diagnostics, GmbH, D, 68298, Mannheim.
27. Hosie, D., Gould, W., Hunter, R., Low, C., Munro, R., Wilson, C., 1986. Acute myopathy in horses at grass in east and south east Scotland. Veterinary Record 119, 444–449.
28. Ivy J.L., D.L. Costill, P.J. Van Handel, D.A. Essig, and R.W. Lower. 1981. Alteration in the lactate threshold with changes in substrate availability. Int. J. Sports Med. 2, 139.
29. Jacobson H, Striker G, Klahr S., 1991. Biochemical alterations in advanced uremic failure. In: Jacobson H, Striker G, Klahr S, editors. The principles and practice of nephrology. Philadelphia (BC): Decker; p. 682–689.
30. Jenkins, R., 2000. Exercise and oxidative stress methodology: a critique. American Journal of Clinical Nutrition 72, 670S–674.
31. Jikko, A., Wakisaka, T., Iwamoto, M. et al., 1998. Effects of interleukin‐6 on proliferation and proteoglycan metabolism in articular chondrocyte cultures. Cell Biology International 22, 615–621.
32. Jones, S., 2005. Directing transition from innate to acquired immunity: defining a role for IL‐6. Journal of immunology 175, 3463–3468
33. Jones, W., 2003. Nutritional Support for Rhabdomyolysis. Journal of Equine Veterinary Science, 23, 325‐326.
34. Kirschvink, N., Art, T., de Moffarts, B., Smith, N., Marlin, D., Roberts, C., Lekeux, P., 2002. Relationship between markers of blood oxidant status and physiological variables in trained and heaves‐affected horses after exercise. Equine Veterinary Journal 34, 159–164.
35. Knochel, P., 1990. Catastrophic medical event with exhaustive exercise: white collar rhabdomyolysis. Kidney International 38, 709‐719.
36. Lee, J., Clarkson, M., 2003. Plasma creatine kinase activity and glutathione after eccentric exercise. Medicine & Science in Sports & Exercise 35, 930–936.
37. Leeuwenburgh, C., Heinecke, J.W., 2001. Oxidative stress and antioxidants in exercise. Current Medicinal Chemistry 8, 829–838.
38. Ley, C., Ekman, S., Ronéus, B., Eloranta L., 2009. Interleukin‐6 and high mobility group box protein‐1 in synovial membranes and osteochondral fragments in equine osteoarthritis Research in Veterinary Science 86 , 490–497
39. Line, L. and Rust, S., 1995. Acute exertional rhabdomyolysis. American Family Physician 52, 502‐506.
40. Marlin, J., Fenn, K., Smith, N., Deaton, D., Roberts, A., Harris, A., Dunster, C., Kelly, J., 2002. Changes in circulatory antioxidant status in horses during prolonged exercise. Journal of Nutrition 132, 1622S–1627S.
41. Mates, M., 2000. Effects of antioxidant enzymes in the molecular control of reactive oxygen species toxicology. Toxicology 153, 83–104.
42. Maughan, J., 1999. Role of micronutrients in sport and physical activity. British Medical Bulletin 55, 683–690.
43. McKenzie, C., Valberg, J. Godden, S., Pagan, D., MacLeay, M., Geor, J., Carlson, P., 2003. Effect of dietary starch, fat and bicarbonate content on exercise responses and serum creatine kinase activity in equine recurrent exertional rhabdomyolysis. Journal of Veterinary Internal Medicine 17, 693–701.
180
Lucrări Științifice – vol 53 seria Medicină Veterinară
44. Mills, C., Smith, C., Harris, C., Harris, P., 1997. Effect of allopurinol on the formation of
reactive oxygen species during intense exercise in the horse. Research in Veterinary Science 62, 11–16.
45. Montgomery, C., and Dymock, J., 1961. The determination of nitrite in water. Analyst 86, 414–416.
46. Nathalie, K., Brieuc, M., Pierre, L., 2008. The oxidant/antioxidant equilibrium in horses. The Veterinary Journal, 177, 178–191.
47. Nieman, C., 1997. Immune response to heavy exertion. Journal of Applied Physiology 82, 1385–1394.
48. Nishikimi, M., Appaji N., and Yogi. K., 1972. The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen. Biochemistry and Biophysics Research Commnication 46, 849‐854
49. Nyblom H., Bergren, U., Balldin, J., Olsson, R., 2004 High AST/ALT ratio may indicate advanced alcoholic liver disease rather than heavy drinking. Alcohol & Alcoholism 39, 336–339.
50. Ohkawa, H., Ohishi, W. and Yagi, k., 1979. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Analytical Biochemistry. 95,351‐358.
51. Palencia, P., Rivero, L., 2007. Atypical myopathy in two grazing horses in northern Spain. Veterinary Record 161, 346–348.
52. Paolisso G, D’Amore A, Giugliano D, Ceriello A, Varrichio M, Dı´Onofrio F. 1993. Pharmacologic doses of vitamin E improve insulin action in healthy subjects and non‐insulin‐dependent diabetic patients. American Journal of Clinical Nutrition 57, 650–6.
53. Pesch, S., Bermann, M. & Bostedt, H. 2006. Determination of some enzymes and macro‐ and microelements in stallion seminal plasma and their correlations to semen quality. Theriogenology 66, 307‐313.
54. Radostits, M., Blood, C., Gay, C., 2007. Veterinary Medicine, A Textbook of disease of cattle, sheep, pigs, goat and horses. 10th Ed., SAUNDERS, ELSEVIER, Edinburgh, London, New York, Oxford, Philadelphia, St Louis, Sydney, Toronto.
55. Reitman, M., and Frankel, S., 1957. A colorimetric method for determination of serum glutamic oxaloacetic and glutamic pyruvic transaminase. American Journal of Clinical Pathology 28, 56.
56. SAS, 2001. Statistical analysis system. In: Users Guide: Statistics. SAS Institute. 57. Shingu, M., Nagai, Y., Isayama, T., Naono, T., Nobunaga, M., and Nagai Y., 1993. The
effects of cytokines on metalloproteinase inhibitors (TIMP) and collagenase production by human chondrocytes and TIMP production by synovial cells and endothelial cells. Journal of Clinical Experimental Immunology 94, 145–149.
58. Shingu, M., Miyauchi, S., Nagai, Y. et al., 1995. The role of IL‐4 and IL‐6 in IL‐1‐dependent cartilage matrix degradation. British Journal of Rheumatology 34, 101–106.
59. Sies, H., 1991. Oxidative stress: introduction. In: Sies, H. (Ed.), Oxidative Stress: Oxidants and Antioxidants. Academic Press, London, pp. XV–XXII.
60. Sjaastad, V., Hove, K., Sand, O., 2004. Physiology of Domestic Animals. Oslo, Scandinavian Veterinary Press. 266‐267.
61. Skenderi, K., Kavouras, S., Anastasiou, C., Yiannakouris, N. & Matalas L., 2006. Exertional Rhabdomyolysis during a 246‐km continuous running race. Medicine & Science in sports and exercise 38, 1054‐1057.
62. Stewart J., Pettigrew A , Cochran A., and Belknap J., 2009. Indices of inflammation in the lung and liver in the early stages of the black walnut extract model of equine laminitis. Veterinary immunology and immunopathology 129, 254‐260.
181
Universitatea de Științe Agricole și Medicină Veterinară Iași
63. Tabacco, A., Meiathini, F., Moda, E., Tarli, P., 1979. Simplified enzymic / colorimetric
serum urea nitrogen determination. Clinical Chemistry 25, 336‐337. 64. Tietz, N., 1995. Clinical Guide to Laboratory Tests, 3rd Edition, W.B. Saunders, Philadelphia,
PA). 65. Trinder, P., 1969. Determination of glucose in blood using glucose oxidase with alternative
oxygen acceptor. Analytical Clinical. Biochemistry 6, 24. 66. Valberg, S., and B. Essen‐Gustavsson. 1987. Metabolic response to racing determined in
pools of type I, IIA, and IIB fibers. In: Gillespie JR, Robinson, NE, eds. Equine Exercise Physiology 2. p. 290. Davis, CA. ICEEP publications.
67. Valberg, J., MacLeay, M., Mickelsen, R., 1997. Exertional rhabdomyolysis and polysaccharide storage myopathy in horses. Compendium on Continuous Education for the Practical Veterinarian 19, 1077–1085.
68. Valentine, A., and Löhr, V., 2007. Myonecrosis in three horses with colic: evidence for endotoxic injury. The veterinary Record 161, 786‐789.
69. Valentine, A., McDonough, P., Chang, F., Vonderchek, A., 2000. Polysaccharide storage myopathy in Morgan, Arabian, and Standardbred related horses and Welsh‐cross ponies. Veterinary Pathology 37, 193–196.
70. Valentine, A., Van Saun, J., Thompson, N., Hintz, F., 2001. Role of dietary carbohydrate and fat in horses with equine polysaccharide storage myopathy. American Veterinary Medical Association 219, 1537‐1544.
71. Votion, M., Linden, A., Saegerman, C., Engels, P., Erpicum, M., Thiry, E., Delguste, C., Rouxhet, S., Demoulin, V., Navet, R., Sluse, F., Serteyn, D., Van Galen, G., Amory, H., 2007. History and clinical features of atypical myopathy in horses in Belgium (2000–2005). Journal of Veterinary Internal Medicine 21, 1380–1391.
72. Walsworth, M., and Kessler, T., 2001. Diagnosing exertional rhabdomyolysis: a brief review and report of two cases. Military Medicine 166, 275‐277.
73. Westermann, M., De Sain‐van der Velden, M., Van der Kolk, H., Berger, R. Wijnberg, D., Koeman, P., Wanders, A., Lenstra, A., Testerink, N. Vaandrager, B., Vianey‐Saban, C., Acquaviva‐Bourdain, C., Dorland L., 2007. Equine biochemical multiple acyl CoA dehydrogenase deficiency (MADD) as a cause of rhabdomyolysis. Molecular Genetics and Metabolism 91, 362–369.
74. White, A., Estrada, M., Walker, K., Wisnia, P., Filgueira, G., Valdes, F., Araneda, O., Behn, C., Martinez, R., 2001. Role of exercise and ascorbate on plasma antioxidant capacity in thoroughbred race horses. Comparative Biochemistry and Physiology. Part A: Molecular and Integrative Physiology 128, 99–104.
75. Whitwell, E., Harris, P., Farrington, G., 1988. Atypical myoglobinuria: an acute myopathy in grazing horses. Equine Veterinary Journal, 20, 357–363.
76. Wootton, P., 1982. Microanalysis in Medical Biochemistry 6 th Ed. Churchill, LTD. London pp. 107.
77. Wroblewski, F., and Duean, S., 1955. Bestimmung der Aktivital der lactate dehydrogenase. Proceedings of Society of Experimental Biology, 90, 210‐214.
78. Young, S., Thomas, W., Friedman, B., Pestaner, C., 1972. Effects of drugs on clinical laboratory tests. Clinical Chemistry 18, 1041–1303.
79. Zentek, J., 1991. Myopathies in a riding horse stable. Tierarztl Prax.19, 167‐9.
182
THE PARS DISTALIS (ANTERIOR PITUITARY) IN ONE‐HUMPED CAMEL (CAMELUS DROMEDARIUS ) : A MORPHOLOGICAL STUDY
IHAB EL_ZOGHBY1* , AHME D KASSAB2
1 Department of Histology and Cytology, 2Department of Anatomy and Embryology and, Faculty of Veterinary Medicine (Moshtohor), Benha University, Egypt;
*Corresponding author: 1
E‐mail: ihabyara@yahoo.com
Abstract : Fourteen pars distalis of one‐humped camels (Camelus dromedarius) were studied using light, scanning and transmission electron microscopes. Camels (9 males and 5 females) ranged from three to five years of age were used in this study. The pars distalis were principally composed of clusters of tightly‐packed cells in the form of anastmosing cords. The cells were separated from each other by collagen fibers and sinusoids of various sizes. The pars distalis of camels included the following cells: mammotrophs, somatotrophs, gonadotrophs, corticotrophs, thyrotrophs and folliculo‐stellate cells. Somatotrophs were the most abundant secretory cells and were readily identifiable by their large homogeneously dense secretory granules. The gonadotrophs contain small secretory granules. Corticotrophs were angular in outline and occasionally possessed finger‐like projections. Thyrotrophs were few in number and contain small scattered secretory granules. The folliculo‐stellate cells were small and contained no secretory granules. The present study showed that the camel pars distalis has five secretory and one non‐secretory cell types, which could be easily differentiated from each other by the number and size of their secretory granules.
Key words: Pars distalis; Camel; Scanning; Transmission Electron Microscope.
INTRODUCTION
It is well known that the mammalian pituitary gland consists of two structurally distinct
lobes, the adenohypophysis and the neurohypophysis. The adenohypophysis consists of the pars distalis, pars intermedia and pars tuberalis (Hanstrom, 1966; Daniel and Prichard, 1975).
The pars distalis forms the main body of the pituitary gland and consists of several types of endocrine cells that secrete at least six trophic hormones (Webb, 1982). The histomorphology of the pars distalis has been studied in various domestic species (Delmann, 1971); in horse (Harrison and Sharyock, 1940; Webb, 1982); in bovine (Dawson, 1948; Bassett, 1951; Cupps et al., 1954; Jubb and McEntee, 1955); in buffaloes (Roy, 1970; Das, 1979); in small ruminants (Trautmann and Fiebiger, 1957; Webb, 1981); in the goat (Singh, 1971; Khatra and Nanda, 1981; Gomez et al., 1989) and in the dog and cat (Das, 1971; Girod and Lheritier, 1986). However, there are no available reports that describe the pars distalis in the camel.
The secretory cells of pars distalis secret at least six hormones: growth hormone (GH), prolactin, adrenocorticotrphic hormone (ACTH), thyroid‐stimulating hormone (TSH),
183
Lucrări Științifice – vol 53 seria Medicină Veterinară luteinizing hormone (LH) and follicle‐stimulating hormone (FSH). Each hormone, with the exception of LH and FSH, is produced by separate cell type (Moriarity, 1973; Nakane, 1975). Each cell type appears to be similar in many mammalian species (Foster, 1971; Farquhar, Skutelsky and Hopkins, 1975). Many of the different cell types can be identified by their ultrastructural morphology; particularly by the size of their secretory granules (Webb, 1981). But there are no studies that dealt with the identification of cell types in the pars distalis of the dromedary camel (Camelus dromedarius)
The two objectives of this study were: firstly, to elucidate a detailed description of the pars distalis in the hypophysis of dromedary camel (Camelus dromedarius) by Scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Secondly, to compare the camel’s pars distalis cell types with pars distalis cells in other domestic animals.
MATERIALS AND METHODS
Nine adult male and five female camels (Camelus dromedarius) ranged from three to
five years of age were used in this study. Samples were obtained from Benha and Toukh slaughterhouses in Egypt. Each pituitary gland was quickly removed from its fossa. The pars distalis were isolated from each pituitary gland and was cut into 1 mm blocks.
For light microscopy, the tissues were fixed in 10% neutral buffered formalin solution then dehydrated, cleared, embedded and cut at 4‐5 microns. The tissues stained with H&E and Crossmon’s trichrome stain according to the methods described by Crossman (1937) and Bancroft, Cook, Stirling, and Turner (1994).
The scanning electron microscopy study was made in Faculty of Agriculture, Alazhar University, Egypt. The specimens were dehydrated in ascending grades of alcohols, isopentyl acetate for 2‐3 days, critical point dried with carbon dioxide, mounted on aluminum holders and coated with gold in a sputtering device. Finally, the structures were examined using a JEOL JSM 5500 LV SEM.
The transmission electron microscopy was made in Almasa Military Veterinary Hospital in Egypt. Small pieces of camel pars distalis were fixed in 2.5% gluteraldehyde solution with 0.1 M phosphate buffer (pH 7.4) for 24‐48 hours, post fixed in 2% osmic acid for 2 hours, dehydrated in ascending grades of alcohols and immersed in propylene oxide. Finally, they were embedded in Epoxy resin. The block was polymerized for 24 hours at 70○C. semithin sections (0.4 µm) were cut with glass knives on an ultramicrotome and stained with 0.3 % toludine blue for light microscopy to determine the orientation of the specimen. The ultrathin sections (70 nm) were cut, mounted on copper mesh grids (No. 200) and stained with saturated solution of uranyl acetate dihydrate. Then, the sections were examined with SEO Electron Microscope. The sizes of granules were determined using the SemAfore software.
RESULTS
The parenchymal cells of the pars distalis were appeared in clusters of tightly‐packed
cells. The cells were arranged in anastmosing cell cords of (Fig. 1) with variable thickness. These cells were covered externally by connective tissue capsule (Fig. 2) and were separated from each other by collagen fibers and sinusoids of various sizes which were lined with endothelium (Fig. 3).
184
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 1. Photomicrograph of camel pars distalis illustrating cord like arrangement of cells (C) and in between sinusoidal vessels (S). The acidophil (A) can be distinguished easily from basophil (B). The pars distalis faces cavum hypophysis (H). H&E. X 200.
Fig. 2. Scanning electron micrograph of camel pars distalis showing connective tissue capsule (arrows) that surrounding the parenchymal cells (C) and sinusoids (S).
Fig. 3. Photomicrograph of camel pars distalis stain with Crossman’s trichrome showing the distribution of the collagen fiber (arrows) among the cell clusters (C) and blood sinusoids (S). X400.
185
Lucrări Științifice – vol 53 seria Medicină Veterinară
There were blood vessels (Fig. 4) between the secretory cells of pars distalis. The wall of the blood vessels was reinforced with a tough collagen fiber and fine scattered fibrils were also observed (Fig. 5). The cells were a mixture of secretory with typical details of protein secreting cells and non‐secretory cell types. The clusters were surrounded by a network of capillaries. The pars distalis of camels included the following cells: mammotrophs, somatotrophs, gonadotrophs, corticotrophs, thyrotrophs and folliculo‐stellate cells.
Fig. 4. Scanning electron micrograph showing a blood vessel (BV) in the camel pars distalis containing blood cells (b) which adjacent to secretory cells (C).
Fig. 5. High magnification Scanning electron micrograph of large blood vessels. Collagen fibrils (c) are randomly distributed along its longitudinal axis. Secretory granules (G) were seen adjacent to the blood vessel and blood cells (b). Mammotrophs and somatotrophs
The mammotrophs and somatotrophs were difficult to distinguish from each other because of their similarity. Somatotrophs were the most abundant secretory cells and tended to be found in groups within a cluster. They were readily identifiable because they contained large homogeneously dense secretory granules. The granules were generally round to ovoid and were scattered either throughout the cytoplasm or concentrated near that part of the
186
Universitatea de Științe Agricole și Medicină Veterinară Iași peripheral cell membrane (Fig. 6 & 7). They were distributed throughout the gland, but with a relatively higher concentration in the antero‐ventral area. Lower concentration of these cells was founded in the dorso‐posterior area. The diameter of the cells varied and the sizes of the secretory granules ranged from 400‐ 1100 nm (Fig. 8).
Fig. 6. Transmission electron micrograph of mammotrophs or somatotrophs from camel pars distalis. Note the nucleus (N) and the dense secretory granules (G) are concentrated near the peripheral cell membrane. A blood vessel (BV) was seen with blood cells (b). Scale bar: 5 µm.
Fig. 7. Scanning electron micrograph from camel pars distalis showing various shape and size of secretory granules.
187
Lucrări Științifice – vol 53 seria Medicină Veterinară
Fig. 8. Transmission electron micrograph of secretory granules
in somatotrophs of camels pars distalis. Note the granules are of high number, large size and density packed. Scale bar: 2 µm
Gonadotrophs
The shape of gonadotrophs varied from angular to ovoid and may be irregular in shape (Fig. 9). Their size and secretory granule number were varied according their activity. The secretory granules were smaller, rounder and their diameters were ranged between about 250 to 850 nm in diameter. These cells were often larger than the somatotrophs and mammotrophs. The cells had a variable number of mitochondria and attached with neighbor cells by junctional complex. The number of secretory granules was quite variable between one cell and another.
The secretory granules in gonadotrophs of camel's pars distalis were darker and denser than those of the somatotrophs and mammotrophs (Fig. 10). The rough endoplasmic reticulum was sparsely distributed. The cytoplasm contained many free ribosomes.
Fig. 9. Transmission electron micrograph of gonadotrophs from camel pars distalis containing small scattered secretory granules (G). Junctional complexes (arrows) were seen between
cells. The nucleus (N) and mitochondria (M) are seen. Scale bar: 5 µm.
188
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 10. Transmission electron micrograph of secretory granules in gonadotrophs of camels pars distalis. Note the granules are of few in number and small in size. Scale bar: 2 µm Corticotrophs
Corticotrophs were few in number and variable in size. They were usually angular in outline and occasionally possessed finger‐like projections (Fig. 11). The projections, which extended between adjacent cells, contained few organelles other than secretory granules. The corticotrophs contained variable numbers of secretory granules scattered throughout the cytoplasm. The granules were usually round, with diameters ranging between 150 to 300 nm.
Fig. 11. Transmission electron micrograph of camel pars distalis containing corticotrophs (Co) surrounded by somatotrophs (So) and gonadotrophs (Go). The corticotrophs has angular
189
Lucrări Științifice – vol 53 seria Medicină Veterinară profile with small secretory granules. Sinusoid (S) is also seen. Scale bar: 5 µm
Thyrotrophs
The thyrotrophs were few in number. They were usually found between gonadotrophs and somatotrophs. The shape of thyrotrophs was angular, ovoid or irregular in outline. They contained variable numbers of small secretory granules and their sizes varied from 100 to 250 nm (Fig. 12). The secretory granules were scattered throughout the cytoplasm. The nucleus was round and eccentrically located.
Fig. 12. Transmission electron micrograph of thyrotrophs (Th) in the camel pars distalis. The nucleus (N) is eccentric ovoid. Somatotrophs (So) and gonadotrophs (Go) are seen. Scale bar: 5 µm. Folliculo‐stellate cells
The folliculo‐stellate cells were small cells contained no secretory granules (Fig. 13) and were distributed between the secretory cells. They possessed long slender cytoplasmic processes which extended between adjacent cells. The nucleus was elongated ovoid or pear shape. The cytoplasm of the folliculo‐stellate cells was dense and frequently contained many free ribosomes, little rough endoplasmic reticulum, small Golgi complexes and few mitochondria. The cells were either found alone, giving them a stellate appearance, or in groups. When in groups they commonly formed follicles with junctional complexes joining one cell to another near the luminal surface. The follicles varied in size and were usually found in the centre of cell clusters. No secretory cells were observed lining the follicles.
190
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 13. Transmission electron micrograph of folliculo‐stellate cells (F) in the camel pars distalis. The nucleus (N) is elongated. Corticotrophs (Co), gonadotrophs (Go) and Junctional complexes (arrows) are seen. Scale bar: 5 µm DISCUSSION
The pars distalis of the camel was composed of glandular cells enclosed by connective tissue and surrounded by a capillary network, like other mammals as in cattle (Gasse et al. 1986; Fumagalli and Zanini, 1985); in goat (Khatra,et al., 1981) and in small ruminants (Trautmann and Fiebiger, 1957 and Dellmann, 1971). These observations also support similar findings in dog and pig ( Das, 1971).
The result of the present study showed that the density of solitary fibrils surrounding the inner surface of vessels seemed to change according to the size. They are denser in the large vessel and are sparser in the small vessels or sinusoids. It may be related to the structural strength of vessels. These finding is agreement with Nishimura et al 2004 in the goat. Also the sinusoids are generally distributed between the cluster according to the endocrine function of the gland which also with agreement with Murray et al. (1997) in human and Townsend et al. (2004) in equine.
Mammotrophs and somatotrophs were the easiest secretory cells to identify. Their secretory granules were lagre and secttered over their cytoplasm, similar to that described by Parry, McMillen, Robinson & Thorburn (1979) in sheep.
Our result revealed that the mammotrophs and somatotrophs are the most abundant secertory cells in the camels pars distalis. While Farquhar et al. (1975) in rat and Foster (1971) in rabbits observed that mammotrophs only were the most abundant secretory cell type. Such cells were readily identifiable due to they were the largest of any pars distalis cell type and their secretory granules are very large.
The gonadotrophs varied from angular to ovoid and may be irregular in shape, similar to that mentioned by Nakane (1975).The aforementioned author observed that the shape of gonadotrophs were large round or angular. Moriarty (1976) found that there were three distinct cell types which contained LH and/or FSH and that their shapes varied from angular or stellate to large and ovoid. Moreover, as secretory activity was increased and a cell lost its population of granules, it became more angular or satellite.
191
Lucrări Științifice – vol 53 seria Medicină Veterinară
The present study showed that somatotrophs and gonadotrophs are completely different by their size and secertory granules. On the other hand, Farquhar et al. (1975) recorded that somatotrophs and gonadotrophs could not be differentiated and proved indistinguishable from each other using morphological criterion of granule size.
Corticotrophs were also identified in this study. The cells exhibited all the characteristics described by many authors following morphological and immunocytochemical studies in several species (Siperstein & Allison, 1965; Foster, 1971; Moriarty, 1973; Farquhar et al., 1975). The corticotrophs were not numerous, which is in agreement with the results of Nakane, Setalo & Mazurkiewicz (1977), who found that the number of corticotrophs in rat pituitary sections represented approximately 15% of the total secretory cell population.
The secretory granules of the thyrotrophs of the camel pars distalis are spherical, numerous and distributed throughout the cytoplasm, in the way described by Shirasawa et al. (1985) in the goat. The secretory granules show their characteristically small size, giving values similar to those found by Shirasawa et al. (1985) especially in the female goat. These results suggest that the size of the secretory granules in the camels tend to be larger than in other species of mammals. The granule content is of a very variable density, which coincides to a certain extent with the diversity which appears in other species. However Shirasawa et al. (1985) observed them as being electrodense in the goat. The folliculo‐stellate cells of the camel pars distalis that were described in this study
characterized by their shape, a granularity, relatively few mitochondria and poor development of RER. On the other hand, Smith (1963) was the first to describe large stellate cells with prominent cytoplasmic fibrillae in the guinea‐pig pituitary. Cells with similar ultrastructural features have been described in the rabbit (Young, et al., 1965; Foster, 1971), in the rat (Farquhar, 1971; Vila‐Porcile, 1972; Farquhar, Skutelsky & Hopkins, 1975) and in the deer (Young & Chaplin, 1975).
Foster (1971) found the cells in the rabbit pituitary with numerous microfilaments and microtubules. He speculated that the cells might be capable of movement and might be concerned in the circulation of intracellular fluid. A phagocytic role has been disscused by Young et al (1965) and Farquhar (1971).
The results for camel pars distalis demonstrate that specific identification techniques (e.g. immunocytochemistry) are required to help identify or verify certain of the pars distalis cell types. REFERENCES
1. Bancroft, J. D.; Cook, H. C.; Stirling, R. W. and Turner, D. R. (1994): Manual of histological techniques and their diagnostic application. 2nd. Churchill Livingston, Edinburgh, London, Madrid, Melbourne, New York, and Tokyo.
2. Bassett, E. G. (1951): The anterior lobe of cattle pituitary. I. Quantitative cell type variation in various normal and abnormal sexual conditions. J. Endocr. 7: 203‐214.
3. Crossman, G. (1937): A modification of Mallory connective tissue stain with a discussion of the principals involved. Anat. Rec. 69: 33‐83.
4. Cupps, P. T.; Laben, R. C. and Mead, S. W. (1954): Histology of the pituitary, testis and adrenal in relation to reproduction in the bull. Dairy Sci. 37: 1074‐1087.
5. Daniel, P.M. and Prichard, M.M.L. (1975) Studies of the hypothalamus and the pituitary gland with special reference to the effects of transaction of the pituitary stalk. Acta Endocrinologica, Suppl. 201.
6. Das, L. N. (1971): Quantitative and histochemical studies on age correlated changes in canine and porcine hypophysis. Ph. D. Dissertation. Iowa University Library Ames.
192
Universitatea de Științe Agricole și Medicină Veterinară Iași
7. Das, L. N. (1979): Observation on subgross morphology of the hypophysis and histomorphology of the neurohypophysis of Indian buffalo. Indian J. Anim. Sci. 49: 531‐ 542.
8. Dawson, A. B. (1948): The relationship of the pars tuberalis to the pars distalis in the hypophysis of the rhesus monkey. Anat. Rec. 102: 103‐ 122.
9. Dellmann, H. D., (1971): Veterinary histology. Lea and Febiger, Philadlphia. 10. Dellmann H.D. and J. Eurell (1998) Textbook of Veterinary Histology 5th Edition, pp
289‐291, Lippincott Williams and Wilkins, Philadelphia.
11. Farquhar, M. G. (1971): Processing of secretory products by cells of anterior pituitary gland. Memoirs of the society for endocrinology. 19, 79‐122.
12. Farquhar, M. G.; Skutelsky, E. H.; and Hopkins, C. R. (1975): Structure and function of the anterior pituitary and dispersed cells. In vitro studies. In ultrastucture in bioological systems. Vol. 7 the anterior pituitary, pp83‐135. Eds A. Tixier‐ Vidal& M.G. Farquhar. Academic Press, New York.
13. Foster, C. L. (1971): Relationship between ultrastructure and function in the adenohypophysis of the rabbit. Mem. Soc. Endocr. 19, 125‐146.
14. Fumagalli, G. and Zanini, A. (1985): In cow anterior pituitary, growth hormone and prolactin can be packed in separate granules of the same cell. J. cell Bio. 100: 2019‐2024.
15. Gasse H. and Schwarz R.(1986): Chromophobe cells and their significance as folliculostellate cells in the pars distalis adenohypophysis in cattle. Dtsch Tierarztl Wochenschr. 7;93(5):224‐8.
16. Girod, C.; and Lheritier, M.; Trouillas, S.and Dubois, M. P. (1986): Cell types of the pars distalis of the hedgehog (Erinaceus europaeus L.) adenohypophysis: cytological, immunocytochemical and ultrastructural studies. 4 thyrotropic cells. Acta Anat. 127, 48‐52.
17. Gomez, M.A.; Navarro, J. A.; Gomez, S.; Camara, P.; Gomez, J. C. and Bernabe, A. (1989): Cytological, immunocytochemical and ultrastructural study of the adenohypophyseal pars distalis of the kid (Capra hircus): The TSH cell. Anat. Histol. Embryol. 18: 305‐315.
18. Hanstrom, B. (1966): Gross anatomy of the hypophysis in mammals> in the pituitary gland, Vol. 1 pp. 1‐57. Eds G. W. Harris & B.T. Donovan. Butterworth, London.
19. Harrison, B. and Sharyock, H. (1940): Cytogenesis in the pars distalis of the horse. Anat. Rec. 78: 449‐471.
20. Jubb, K. V., and McEntee, K. (1955): Observations on the bovine pituitary gland. II. Architecture and cytology with special reference to basophil cell function. Cornell Vet. 45: 593‐641.
21. Khatra, G.S. and Nanda, B. S. (1981): Age related changes in the histomorphology of the adenohypophysis of the goat. Anat. Histol. Embryol. 10: 238‐245.
22. Moriarity, G. C. (1973): Adenohypophysis: utltrastructural cytochemistry (a review). J. Histochem. Cytochem. 21:855‐894.
23. Moriarty, G. C. (1976): Immunocytochemistry of the pituitary glycoprotein hormones. Journal of Histochemistry and Cytochemistry, 24, 846—863.
24. Murray, K.; De Lera, J. M.; Astudillo, A. and McNicol, A. M. (1997): Organization of basement membrane components in the human adult and fetal pituitary gland and in pituitary adenomas. Virchows Arch 431:329‐335.
193
Lucrări Științifice – vol 53 seria Medicină Veterinară
25. Nakane, P. F. (1975): Identification of anterior pituitary cells by immune‐electron microscopy in: the anterior pituitary (A. Tixier‐ Vidal and M.G. FARQUHAR, eds.), PP. 45‐61. Academic Press, New York.
26. Nakane, P. K.; Setalo, G. and Mazurkiewicz, J. E. (1977): The origin of ACTH cells in rat anterior pituitary. Ann. N. Y. Acad. Sci. 297: 201‐204.
27. Nishimura, S.; Tabata, S.; Nakamura, Y.; Okano, K. and Iwamoto, H. (2004): Three dimension architecture and distribution of collagen components in the goat hypophysis. Anat. Rec. I, 277: 275‐286.
28. Parry, D. M.; McMillen, I. C.; Robinson, J. S. and Thorburn, G. D. (1979): immunocytochemical localization of prolactin and growth hormone in the prenatal sheep pituitary. A morphological and quantitative study. Cell Tiss. Res. 197, 501‐514.
29. Roy, M. K. (1970): Histological and certain histochemical studies on the endocrine glands of buffalo. M.V.Sc thesis Agra university library, Agra.
30. Shirasawa, N.; Kihara, H. and Yoshimura, F (1985): Fine structural and immunohistochemical studies of goat’s adenohyopohysial cells. Cell tissue Res. 240, 315‐321.
31. Singh, Y. (1971): Morphogenesis of the pituitary gland in goat. Ph. D. Dissertation. Haryana Agricultural University Library, Hissar.
32. Siperstein, E. R. and Allison, V. F. (1965): Fine structure of the cells responsible for secretion of Adrenocorticotrophin in the adrenalectomized rat. Endocrinology, 76, 70‐79.
33. Smith, R. E. (1963): An electron microscopic study of the adenohypophysis of guinea pig (abstract). Anat. Rec. 154: 352.
34. Townsend, J.; Sneddon, C. L. and Tortonese, D. J. (2004): Gonadotroph heterogeneity, Density and Distribution, and Gonadotroph‐Lactotroph Association in the Pars Distalis of the Male Equine Pituitary Gland. J. neuroendocrinology 16:432‐440.
35. Trautmann, A. and Fiebiger, J. (1957): Fundamental of histology of domestic animals. Translated and revised by Habel, R. E., and E. L. PIPERSTEIN, Cumstock publishing associate, Ithaca.
36. Vila‐Porcile, E. (1972): Léraseau des cellules folliculo‐stellaires et nes follicules dé I’adenohypophyse du rat (pars distalis). Z. Zellforsch. 129: 328‐369.
37. Webb, P. D. (1981): The pars distalis (anterior pituitary) sheep: an ultrastructural study. J. devl. Physiol. 3: 319‐332.
38. Webb, P. D. (1982): Ultrastructural study of the development of the pars distalis (anterior pituitary) in the foal. J. Reprod. Fert. Suppl. 32:583‐588.
39. Young, P. A., and Chaplin, R. E. (1975): Some observations on the ultrastructure of the adenohypophysis of certain cervidae. J. Zoo. 175:493‐508.
40. Young P. A.; Foster, C. L. and Cameron, E. (1965): Some observations on the ultrastructure of the rabbit. J. Endocrinology. 31: 279‐287.
194
LIGHT AND ELECTRON MICROSCOPE STUDIES OF THE ADRENAL GLANDS OF THE EGYPTIAN GEESE
(ALOPOCHEN AEGYPTIACUS)
Ihab M. EL‐Zoghby Department of Histology and Cytology,
Faculty of Veterinary medicine (Moshtohor), Benha University, Egypt. E‐mail: ihabyara@yahoo.com
ABSTRACT: Twenty mature and immature male and female Egyptian geese, ranged in age from three to eighteen months, were used in this study. The adrenal glands of the Egyptian geese were paired organs weighing approximately 200‐250 mg (7.5 mg/100 g body weight) and were situated anterior to the kidneys on each side of the dorsal aorta and inferior vena cava. Each adrenal gland was surrounded from outside by a connective tissue capsule. The interstitial tissue was rich in blood vessels, collagen, and reticular fibers. The parenchyma cells of the adrenal gland were arranged in cords especially at sub‐capsular zone (SCZ). Thin layers of connective tissue separated these cords and there were two types of cells: acidophilic and basophilic cells, which intermingle with each other and are separated by sinusoids. The acidophilic cells were large, polyhedral to columnar in shape, with a highly vacuolated and lightly stained acidophilic cytoplasm; while the cells of inner cords were large columnar and are less vacuolated. Ultrastructurally, these cells could be classified into two types, according to the amount of lipid droplets and mitochondria: cells that contained numerous lipid droplets with few somewhat large globular mitochondria, and the other type were cells containing few lipid droplets. Basophilic cells were bluish islets or scattered groups found in‐between the acidophilic cells. According to the shape of the secretory granules, these cells could be classified into two types: cells that contained homogenous, polymorphic electron dense secretory granules, and cells that contained secretory granules of electron dense core surrounded by hallow electron lucent coat. With the increasing the age of the geese, the connective tissue capsule became thick and the interstitial tissue was increased. The acidophilic cells of the inner zone were more vacuolated and less acidophilic and slightly numerous in the peripheral, acidophilic cells than in those of the inner zones. The basophilic cells appeared less vacuolated and were smaller.
Key words: Egyptian Geese, Adrenal gland, Light and Transmission Electron Microscope.
INTRODUCTION The role of the adrenal gland is more difficult to be evaluated in geese than in
mammals. The difficulties are partly related to the intermingling of the cortical and medullary tissues. It is generally accepted that the cortex of the geese adrenal gland cannot be divided into the three distinct zones (zona glomerulosa, zona fasciculata, and zona reticularis) as in its mammalian counterparts (Gulmez, Kocamis, Liman and Kukner, 2004). The adrenal gland is an indispensable endocrine organ; it is a complex organ concerned with the production of multiple hormones and performs many kinds of physiological functions. The adrenal gland is as important in birds as it is in mammals; and the removal of the adrenal gland in birds eventually leads to death (Peng, Chen and Liang, 2005). Morphological studies of the adrenal gland have been reported in pigeon ( Bhattacharyya, 1975), Canadian goose (Gulmez et al., 2004), and in Wanxi white geese
195
Lucrări Științifice – vol 53 seria Medicină Veterinară (Wang, Zhu and Jin, 1999), in fowl (Siller, Teague and Mackenzie, 1975), in quail (Basha, Vijayaragavan and Ramesh, 2004), in duck (Pearce, Cronshaw and Holmes, 1978) and in African ostrich chicks (Li Tang, Peng, Wang, Luo, Cheng, Zhang, Sun, Liu, and Song, 2009). However, little attention was paid especially to the morphology of the adrenal glands in Egyptian geese, and the glands ultrastructure remains obscure.
The purpose of this study was to provide a concise account of general morphology, the cellular and sub cellular structures of the adrenal glands in Egyptian geese, and to compare them with those observations in other birds. This would hopefully contribute to the understanding of the features of the adrenal gland in birds in general, and of adrenal glands of Egyptian geese morphology, in particular.
MATERIALS AND METHODS
Twenty mature and immature male and female Egyptian geese were collected from
EL‐Qaliubiya Province in Egypt. Each sex was represented by ten birds that ranged in age from three to eighteen months. The birds were anaesthetized using 10% urethane, (1 g/kg body weight), and were sacrificed. The paired adrenal glands were carefull dissected and removed from each sample and then cut into 1 mm blocks. Tissues for light microscopy were fixed in 10% neutral buffered formalin solution and Bouin’s solution for 72 h, then dehydrated, cleared, and embedded in paraffin. Sections (5 ‐ 6 microns) were cut and stained with haematoxylin and eosin and Crossman’s trichrome stain and Gomeri’s reticulin and Periodic acid Schiff according to the methods given by (Crossman, 1937; Bancroft, Cook, Stirling, and Turner 1994).
The transmission electron microscopy evaluation was conducted at Science collage of Ain Shams University in Egypt. Small pieces of adrenal gland were fixed in 2.5% gluteraldehyde solution with 0.1 M phosphate buffer (pH 7.4) for 24‐48 hours, post fixed in 2% osmic acid for 2 hours, dehydrated in ascending grades of alcohols and immersed in propylene oxide. Finally, they were embedded in Epoxy resin. The block was polymerized for 24 hours at 70○C. The ultrathin sections (70 nm) were cut, mounted on copper mesh grids (No. 200) and stained with saturated solution of uranyl acetate dihydrate and lead citrate as described by Chiu, Schmidt and Prasad (1993). Then, the sections were examined with Jeol JEM 100S Transmission electron microscope (70KV).
RESULTS
The adrenal glands of the adult Egyptian geese were paired organs weighing approxi‐
mately 200‐250 mg (7.5 mg/100 g body weight) and were situated anterior to the kidneys on each side of the dorsal aorta and inferior vena cava. The glands measured approximately 7.5 mm in length and 5mm in width, and in transverse section, it appeared either triangular or oval with a thickness ranging from 3.5 to 4.5 mm.
The adrenal gland was surrounded from outside by connective tissue capsule (Fig. 1) that contained mainly collagen fibers (Fig. 2), reticular fibers, with very few elastic elements, blood vessels and fibroblasts. Delicate septa were arising from the capsule and were ramifying between parenchyma tissues form the interstitial tissue. The interstitial tissue was rich in blood vessels, reticular fibers (Fig. 3) which surrounded both types of cells and sinusoids. Groups of ganglionic cells are found both outside (Fig. 4) and inside the gland’s parenchyma.
196
Universitatea de Științe Agricole și Medicină Veterinară Iași
subcapsular zone, two cells wide (Fig. 5), and the cells were orientated so that their longitudinal axes were transverse to the cord and the nucleus in each cell was situated toward the outer margin. Thin layers of connective tissue separated these cords and there were two types of cells (Fig. 5): acidophilic and basophilic cells. These cells intermingled with each other and were separated by sinusoids (Fig. 6).
The first type of cells, the acidophilic cells, was arranged in two‐ cells wide cords that rested on PAS positive membrane (Fig. 7&7a). At peripheral (subcapsular) zone, these cells were arranged in clumps forming loops directed opposite to the capsule. These cells were large, polyhedral to columnar with highly vacuolated and lightly stained acidophilic cytoplasm. The cells of inner cords were large columnar cells and are less vacuolated. The nuclei of acidophilic cells were rounded, apically located and contained one or two prominent nucleoli. Ultrastructurally, the acidophilic cells appeared columnar in shape, their cytoplasm contained numerous globular mitochondria, and many ribosomes, lipid droplets (Fig. 8), and smooth and rough endoplasmic reticulum and their nuclei were spherical, large contained prominent nucleoli and coarse chromatin. These cells could be classified into two types, according to the amount of lipid droplets and mitochondria, cells contained numerous lipid droplets (Fig. 8) with few somewhat large globular mitochondria and the other type were cells containing few lipid droplets (Fig. 9).
The second type of cells, the basophilic cells, were found in the form of islets that appeared, with general stain, as bluish islets or scattered groups in between the acidophilic cells (Fig. 10). They were polygonal or rounded in shape with basophilic cytoplasm and large spherical centrally located nuclei that contained two or even three nucleoli. According to the affinity of the cytoplasm to the stain, the basophilic cells could be differentiated into two types: cells with deeply stained basophilic cytoplasmic granules, and cells with lightly stained basophilic cytoplasmic granules (Fig. 10a). The blood sinusoids were found between the cell cords and islets, and were numerous and wider in the center of the gland than in the peripheral zone of the gland. The peripheral zone were formed mainly from the first type of cells where, the inner zones formed of large amount of second type of cells and a few of first type of cells.
TEM revealed that the cytoplasm of the basophilic cells contained rod shaped mitochondria with tubular cristea, ribosomes, a few rough endoplasmic reticulum, lipid droplets and secretory granules. According to the shape of the secretory granules, these cells could be further classified into two types: cells that contained homogenous, polymorphic electron dense secretory granules (Fig. 11), and cells that contained secretory granules of electron dense core surrounded by hallow electron lucent coat (Figs. 12 &13).
With the increasing the age of the gees, the connective tissue capsule became thicker, and the amount of the interstitial tissues increased (Fig. 14). The acidophilic cells of the inner zone were more vacuolated and less acidophilic, and the vacuoles were slightly numerous in the peripheral acidophilic cells than in those cells of the inner zones. The basophilic cells appeared less vacuolated and smaller.
FIGURE LEGENDS Fig. 1. Photomicrograph in geese adrenal gland of three months old female showing the capsule(c), blood vessel (bv), parenchyma of the gland (p), acidophilic cells (a) and basophilic cells (b) H&E. X 100. Fig. 2. Photomicrograph in geese adrenal gland of seven months old female showing the collagen fibers (cf), blood sinusoids (bs) and blood vessels (bv). Crossman’s trichrome stain. X 100.
The parenchyma cells of adrenal gland were arranged in cords especially at
197
Lucrări Științifice – vol 53 seria Medicină Veterinară Fig. 3. Photomicrograph in geese adrenal glands of seven months old female with Gomori’s reticulin methods showing the distribution of the reticular fiber (rt) among the of the gland parenchyma X400. Fig. 4. Photomicrograph in geese adrenal glands of ten months old female showing the capsule (c), parenchyma (p) and ganglionic cells (arrows). H&E. X 200. Fig. 5. Photomicrograph in geese adrenal glands of ten months old female showing the two cells width forming the cords also, blood sinusoid (bs), acidophilic cells (a) and basophilic cells (b). H&E. X 600 Fig. 6. Transmission electron micrograph from eleven months male of geese adrenal gland showing blood sinusoid (bs) and thin layer of connective tissue between the cells of the glands. X2000. Fig. 7. Photomicrograph in geese adrenal glands of seven months old male showing the septa between the cell (s) and & Fig. 7a.showing the positive membrane (arrows) of the same age and sex. PAS technique X 100 and 1000 respectively. Fig. 8. Transmission electron micrograph from eleven months male of geese adrenal gland showing the subcapsular columnar cells with the nucleus (s), cell membrane (cm), mitochondria (m) and large number of fat droplet (f) in their cytoplasm. X4000. Fig. 9. Transmission electron micrograph from eleven months male of geese adrenal gland showing the other subcapsular columnar cells with low fat droplet (f) in their cytoplasm and mitochondria (m). X3000. Fig. 10. Photomicrograph in geese adrenal glands of twelve months old male showing the distribution of basophilic cells (b) in inner zone of the gland between the acidophilic cells (a) also blood sinusoids (bs). Fig. 10a. Showing the two types of basophilic, one deeply stain (d) and other lightly stains (l) of the same age and sex. H&E. X100 and 600 respectively. Fig. 11. Transmission electron micrograph in geese adrenal glands of twelve months old male showing the basophilic cells containing nucleus (n), cell membrane (cm), mitochondria (arrows) and secretory granules (sg). X1000. Fig. 12. Transmission electron micrograph in geese adrenal glands of twelve months old male showing the distribution of the two types cells of basophilic cells. Cells contained homogenous, polymorphic electron dense secretory granules (1) and cells contained secretory granules of electron dense core surrounded by hallow electron lucent coat (2). X3000.
198
Universitatea de Științe Agricole și Medicină Veterinară Iași
199
Lucrări Științifice – vol 53 seria Medicină Veterinară
200
Universitatea de Științe Agricole și Medicină Veterinară Iași
Fig. 13. High magnification transmission electron micrograph in geese adrenal glands of twelve months old male showing the difference of the secretory granules of basophilic cells, homogenous, polymorphic electron dense secretory granules (1) and secretory granules of electron dense core surrounded by hallow electron lucent coat (2) Fig. 14. . Photomicrograph in geese adrenal of eighteen months old female showing the thick capsule(c), blood vessel (bv), subcapsular zone (scz) containing acidophilic cells. H&E. X 1000. DISCUSSION
The birds are quite different from the mammals in that their adrenal glands are distinctly
divided into an outer cortex, and a medulla that lies in the center of the gland, because of the scattered chromaffin tissue pervaded with islands between the cortical cells (Luo, 1983; and Li, Luan, Yue and Zh, 2003). For geese in this study, the parenchyma tissue was intermingled with each other, which generally agrees with the description of avian adrenal gland provided by Unsicker (1973), Aire, (1981) and Cronshaw, Holmes, Ely, and Redondo (1989) for mallard duck. The present study also revealed that the parenchyma of adrenal gland of Egyptian geese consisted of two types of cells intermingled with each other. These cells are acidophilic and basophilic cells. The former cells is largely found in the outer zone of the gland, while the latter type is concentrated in the center of the gland. These results are in agreement with Sinha and Ghosh (1961) in pigeon, Ghosh (1962) in avian, and with Vyas and Jacob (1976) in Indian avian species.
In ostrich chicks, the interrenal tissues and the t issue of the medulla intermingle with each other, which generally agrees with the description of other avian species. Beesides, the adrenal glands of ostrich chicks appeared to show larger amount of interrenal tissue (Li et al., 2009) than other avian species.
The peripheral zone of the adrenal gland is arranged in clumps forming loops reverse to the capsule, which is lined by columnar cells which are highly vacuolated lightly acidophilic while those of the inner cords were large and less vacuolated but more acidophilic. As observed by T.E.M, there are two types of cells according to the amount of lipid droplets and mitochondria, these finding are similar to those described by Gulmez, Kocamis, Liman and Kukner (2004) in goose (Anser Anser); while in parakeet, quail, and myna adrenal it was that the subcapsular zone cells in quail continued inside the gland as a double‐ layered central
201
Lucrări Științifice – vol 53 seria Medicină Veterinară cords (Bhattcharyya and Ghosh, 1972). The central cords consisted of high columnar cells with nuclei that were localized in adjacent layer of cells. In parakeets, they found that subcapsular zone cells were vacuolated and their nuclei were localized adjacent to the basement membrane. Also, the cytoplasm of internal zone cells consisted of columnar epithelium that was dense and basophilic. In Wanxi white geese, the cell cords in SCZ were arranged tightly, parallel to each other, and were perpendicular to the capsule, which consisted of high columnar cells with a lightly stained cytoplasm and a central nucleus (Wang et al., 1999). The arrangement of these cell cords is similar to those of the fascicular zone in mammalian adrenal gland.The two types of cells, found in the center of the gland, could be differentiated according to the affinity of their cytoplasm to the stain: cells with deeply stained basophilic cytoplasmic granules, and cells with lightly stained basophilic granules. Hodges (1974) has related the variation of the basophilia of medullary cells to the physiological activity of the cells. In this respect, Telford and Bridgman (1990) showed that there are two cell populations in the medulla of adrenal gland of mammals, about 80% of theswe cells synthesize epinephrine and the remainder of the cells produce norepinephrine. In birds, the interrenal or cortical tissue is of mesodermal origin and secretes the corticosteroid hormones, while the chromaffin or medullary tissue is of ectodermal origin and secretes adrenaline and noradrenaline (Assenmacher, 1972; and Mori and George,1978). Medullary cells in duck are characterized by a large population of electron opaque neurosecretory granules. These cells contain fewer mitochondria and cisternae of endoplasmic reticulum than the cortical cells Cronshaw, Holmes and Loeb (1974). In Japanese quails, medullary cells have polyhedral shape and centrally located nucleus. Close to the centrally located nucleus, a moderate number of mitochondria, endoplasmic reticulum and well developed Golgi complex can be found. Catecholamine‐containing secretory granules in both Epinephrine and Norepinephrine cells are enveloped by a continuous membrane and granules of Epinephrine are much smaller in size and more in number than that in Norepinephrine, in duck (Klingbeil, Holmes, Pearce, and Cronshaw, 1979), in avian (Manna and Ghosh, 1979) and in quail Cigankova, Zibrin, Boda, and Holovska, 2005).
The results of the present study for Adrenal glands of Egyptian geese demonstrated that the uses of specific identification techniques (e.g. immunocytochemistry) are required to help identify or verify certain of cell types.
REFERENCES
1. Aire, T. A. (1981): Morphometric study of the avian adrenal gland. J. Anat. 131, 19‐23 2. Assenmacher, I. (1972): The peripheral endocrine glands; in I Farner and King, Avian
biology, vol.3, pp. 184‐J 287 ,Academic Press, New York. 3. Bancroft, J. D.; Cook, H. C.; Stirling, R. W. and Turner, D. R. (1994): Manual of histological
techniques and their diagnostic application. 2nd. Churchill Livingston, Edinburgh, London, Madrid, Melbourne, New York, and Tokyo.
4. Basha, S.H., Vijayaragavan, C., Ramesh, G., (2004): Light and electron microscopic studies on the interrenal tissue of the adrenal gland in Japanese quail (Coturnix coturnix japonica). Indian J. Anim. Sci. 74, 1021–1023.
5. Bhattacharyya, T.K., (1975): Fine structure of the interrenal cell in the quail and the pigeon. Anat. Embryol. (Berl.) 146, 301–310.
6. Bhattacharyya, T.K., & Ghosh, A. (1972): Cellular modification of interrenal tissue induced by corticoid therapy and stress in three avian species. Am. J. Anat, 133, 483‐494.
202
Universitatea de Științe Agricole și Medicină Veterinară Iași 7. Chiu, W.; Schmidt, M. F., and Prasad, B. V. V. (1993): Teaching electron diffraction and
imaging of macromolecules. Biophys. J., 64:1610‐1625. 8. Cigankova, V., Zibrin, M., Boda, K., Holovska, K., (2005): Effect of long‐term
experimental hypodynamy on the adrenal glands of Japanese quails: an ultrastructural study. B. Vet. I. Pulawy 49, 449–453.
9. Cronshaw J, Holmes, W. N., Ely, J. A. and Redondo, J. L. (1989):Pre‐natal development of the adrenal gland in the mallard duck (Anas platyrhynchos). Cell Tissue Res. 258(3):593‐601.
10. Cronshaw, J., Holmes, W. N., Loeb, S. L., (1974): Fine structure of the adrenal gland in the duck (Anas platyrhynchos). Anat. Rec. 180, 385–405.
11. Crossman, G. (1937): A modification of mallory connective tissue stain with discussion of the principle involved. Anat. Rec. 69, 33‐38.
12. Ghosh, A. (1962): A comparative study of the histochemistry of the avian adrenals. In Progress in comparative endocrinology. Gen. Comp. Endocrinol. Suppl. 1:75‐80.
13. Gulmez, N., Kocamis, H., Liman, N., Kukner, A., (2004): Interrenal cell zonation in the adrenal gland of the goose (Anser anser). Growth Dev. Aging 68, 11–18.
14. Hodges, R. D. (1974): The histology of the fowl. (Endocrine chapter, pp 464:474). Academic Press. London, New York, San Francisco.
15. Klingbeil, C.K., Holmes, W. N., Pearce, R. B., and Cronshaw, J. (1979): Functional significance of interrenal cell zonation in the adrenal gland of the duck (Anas platyrhynchos). Cell Tissue Res. 2; 201 (1):23‐36.
16. Li, D. X., Luan, W. M., Yue, Zh. P., (2003): Animal Histology and Embryology. Jilin Peo‐ ple’s Press, Changchun, pp. 230–231 (in Chinese).
17. Li Tang, Peng,k., Wang, J. Luo, H., Cheng, J., Zhang, G., Sun, Y., Liu, H.and Song, H. (2009): The morphological study on the adrenal gland of African ostrich chicks. Tiss. And cell 41:231‐238.
18. Luo, K., (1983): Anatomy and Histology of Domestic Fowls. Fukien Science Publishers Press, Foochow, pp. 187–189.
19. Manna, C. K, and Ghosh, A. (1979): Comparative cytomorphology of the avian adrenocortical tissue. Z Mikrosk Anat Forsch. 93(1):104‐12.
20. Mori, J. G. and George, J. C. (1978): Seasonal histological changes in the gonads, thyroid and adrenal of the Canada goose (Branta canadensis interior). Acta anat. 101: 304‐324.
21. Pearce, R. B., Cronshaw, J., Holmes, W. N., (1978): Evidence for the zonation of interrenal tissue in the adrenal gland of the duck (Anas platyrhynchos). Cell Tissue Res. 192, 363–379.
22. Peng, K.M., Chen, Y.X., Liang, Z.S. (2005) Anatomy of the Domestic Animals and Fowls. Higher Education Press, Beijing, pp. 286.
23. Siller, W. G., Teague, P. W. and Mackenzie, G. M. (1975): The adrenal cortico‐medullary ratio in the fowl. Br Poult Sci. 16(4):335‐42.
24. Sinha, D. and Ghosh, A. (1961): Some aspects of adrenocortical cytochemistry in the domestic pigeon. Endkrinologie 40: 270‐280.
25. Telford, R. I. and Bridgman, F. C. (1990): Introduction to functional histology. 1st Ed. Harper and Eow, Publishers, New York.
26. Unsicker, K. (1973): Fine structure and innervation of the avian adrenal gland. Non‐cholinergic nerve fibers. Z. Zellforsch. 145, 557—575
27. Vyas, D. K., Jacob, D. (1976): Seasonal study of the adrenal gland of some Indian avian species. Acta Anat (Basel). 95(4):518‐28.
28. Wang, J., Zhu, L.L., Jin, G.M., (1999): Study on adrenal glands of Wanxi white geese. J.Anhui Agric. Techn. Teach. Coll. 13, 1–4.
203
top related